PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)

PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1) #

PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)

NNAAMMEE #

 perlretut - Perl regular expressions tutorial

DDEESSCCRRIIPPTTIIOONN #

 This page provides a basic tutorial on understanding, creating and using
 regular expressions in Perl.  It serves as a complement to the reference
 page on regular expressions perlre.  Regular expressions are an integral
 part of the "m//", "s///", "qr//" and "split" operators and so this
 tutorial also overlaps with "Regexp Quote-Like Operators" in perlop and
 "split" in perlfunc.

 Perl is widely renowned for excellence in text processing, and regular
 expressions are one of the big factors behind this fame.  Perl regular
 expressions display an efficiency and flexibility unknown in most other
 computer languages.  Mastering even the basics of regular expressions
 will allow you to manipulate text with surprising ease.

 What is a regular expression?  At its most basic, a regular expression is
 a template that is used to determine if a string has certain
 characteristics.  The string is most often some text, such as a line,
 sentence, web page, or even a whole book, but it doesn't have to be.  It
 could be binary data, for example.  Biologists often use Perl to look for
 patterns in long DNA sequences.

 Suppose we want to determine if the text in variable, $var contains the
 sequence of characters "m u s h r o o m" (blanks added for legibility).
 We can write in Perl

  $var =~ m/mushroom/

 The value of this expression will be TRUE if $var contains that sequence
 of characters anywhere within it, and FALSE otherwise.  The portion
 enclosed in '/' characters denotes the characteristic we are looking for.
 We use the term _p_a_t_t_e_r_n for it.  The process of looking to see if the
 pattern occurs in the string is called _m_a_t_c_h_i_n_g, and the "=~" operator
 along with the "m//" tell Perl to try to match the pattern against the
 string.  Note that the pattern is also a string, but a very special kind
 of one, as we will see.  Patterns are in common use these days; examples
 are the patterns typed into a search engine to find web pages and the
 patterns used to list files in a directory, _e_._g_., ""ls *.txt"" or ""dir
 *.*"".  In Perl, the patterns described by regular expressions are used
 not only to search strings, but to also extract desired parts of strings,
 and to do search and replace operations.

 Regular expressions have the undeserved reputation of being abstract and
 difficult to understand.  This really stems simply because the notation
 used to express them tends to be terse and dense, and not because of
 inherent complexity.  We recommend using the "/x" regular expression
 modifier (described below) along with plenty of white space to make them
 less dense, and easier to read.  Regular expressions are constructed
 using simple concepts like conditionals and loops and are no more
 difficult to understand than the corresponding "if" conditionals and
 "while" loops in the Perl language itself.

 This tutorial flattens the learning curve by discussing regular
 expression concepts, along with their notation, one at a time and with
 many examples.  The first part of the tutorial will progress from the
 simplest word searches to the basic regular expression concepts.  If you
 master the first part, you will have all the tools needed to solve about
 98% of your needs.  The second part of the tutorial is for those
 comfortable with the basics and hungry for more power tools.  It
 discusses the more advanced regular expression operators and introduces
 the latest cutting-edge innovations.

 A note: to save time, "regular expression" is often abbreviated as regexp
 or regex.  Regexp is a more natural abbreviation than regex, but is
 harder to pronounce.  The Perl pod documentation is evenly split on
 regexp vs regex; in Perl, there is more than one way to abbreviate it.
 We'll use regexp in this tutorial.

 New in v5.22, "use re 'strict'" applies stricter rules than otherwise
 when compiling regular expression patterns.  It can find things that,
 while legal, may not be what you intended.

PPaarrtt 11:: TThhee bbaassiiccss SSiimmppllee wwoorrdd mmaattcchhiinngg The simplest regexp is simply a word, or more generally, a string of characters. A regexp consisting of just a word matches any string that contains that word:

     "Hello World" =~ /World/;  # matches

 What is this Perl statement all about? "Hello World" is a simple double-
 quoted string.  "World" is the regular expression and the "//" enclosing
 "/World/" tells Perl to search a string for a match.  The operator "=~"
 associates the string with the regexp match and produces a true value if
 the regexp matched, or false if the regexp did not match.  In our case,
 "World" matches the second word in "Hello World", so the expression is
 true.  Expressions like this are useful in conditionals:

     if ("Hello World" =~ /World/) {
         print "It matches\n";
     }
     else {
         print "It doesn't match\n";
     }

 There are useful variations on this theme.  The sense of the match can be
 reversed by using the "!~" operator:

     if ("Hello World" !~ /World/) {
         print "It doesn't match\n";
     }
     else {
         print "It matches\n";
     }

 The literal string in the regexp can be replaced by a variable:

     my $greeting = "World";
     if ("Hello World" =~ /$greeting/) {
         print "It matches\n";
     }
     else {
         print "It doesn't match\n";
     }

 If you're matching against the special default variable $_, the "$_ =~"
 part can be omitted:

     $_ = "Hello World";
     if (/World/) {
         print "It matches\n";
     }
     else {
         print "It doesn't match\n";
     }

 And finally, the "//" default delimiters for a match can be changed to
 arbitrary delimiters by putting an 'm' out front:

     "Hello World" =~ m!World!;   # matches, delimited by '!'
     "Hello World" =~ m{World};   # matches, note the paired '{}'
     "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
                                  # '/' becomes an ordinary char

 "/World/", "m!World!", and "m{World}" all represent the same thing.
 When, _e_._g_., the quote ('"') is used as a delimiter, the forward slash '/'
 becomes an ordinary character and can be used in this regexp without
 trouble.

 Let's consider how different regexps would match "Hello World":

     "Hello World" =~ /world/;  # doesn't match
     "Hello World" =~ /o W/;    # matches
     "Hello World" =~ /oW/;     # doesn't match
     "Hello World" =~ /World /; # doesn't match

 The first regexp "world" doesn't match because regexps are by default
 case-sensitive.  The second regexp matches because the substring 'o W'
 occurs in the string "Hello World".  The space character ' ' is treated
 like any other character in a regexp and is needed to match in this case.
 The lack of a space character is the reason the third regexp 'oW' doesn't
 match.  The fourth regexp ""World "" doesn't match because there is a
 space at the end of the regexp, but not at the end of the string.  The
 lesson here is that regexps must match a part of the string _e_x_a_c_t_l_y in
 order for the statement to be true.

 If a regexp matches in more than one place in the string, Perl will
 always match at the earliest possible point in the string:

     "Hello World" =~ /o/;       # matches 'o' in 'Hello'
     "That hat is red" =~ /hat/; # matches 'hat' in 'That'

 With respect to character matching, there are a few more points you need
 to know about.   First of all, not all characters can be used "as-is" in
 a match.  Some characters, called _m_e_t_a_c_h_a_r_a_c_t_e_r_s, are generally reserved
 for use in regexp notation.  The metacharacters are

     {}[]()^$.|*+?-#\

 This list is not as definitive as it may appear (or be claimed to be in
 other documentation).  For example, "#" is a metacharacter only when the
 "/x" pattern modifier (described below) is used, and both "}" and "]" are
 metacharacters only when paired with opening "{" or "[" respectively;
 other gotchas apply.

 The significance of each of these will be explained in the rest of the
 tutorial, but for now, it is important only to know that a metacharacter
 can be matched as-is by putting a backslash before it:

     "2+2=4" =~ /2+2/;    # doesn't match, + is a metacharacter
     "2+2=4" =~ /2\+2/;   # matches, \+ is treated like an ordinary +
     "The interval is [0,1)." =~ /[0,1)./     # is a syntax error!
     "The interval is [0,1)." =~ /\[0,1\)\./  # matches
     "#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/;  # matches

 In the last regexp, the forward slash '/' is also backslashed, because it
 is used to delimit the regexp.  This can lead to LTS (leaning toothpick
 syndrome), however, and it is often more readable to change delimiters.

     "#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!;  # easier to read

 The backslash character '\' is a metacharacter itself and needs to be
 backslashed:

     'C:\WIN32' =~ /C:\\WIN/;   # matches

 In situations where it doesn't make sense for a particular metacharacter
 to mean what it normally does, it automatically loses its metacharacter-
 ness and becomes an ordinary character that is to be matched literally.
 For example, the '}' is a metacharacter only when it is the mate of a '{'
 metacharacter.  Otherwise it is treated as a literal RIGHT CURLY BRACKET.
 This may lead to unexpected results.  "use re 'strict'" can catch some of
 these.

 In addition to the metacharacters, there are some ASCII characters which
 don't have printable character equivalents and are instead represented by
 _e_s_c_a_p_e _s_e_q_u_e_n_c_e_s.  Common examples are "\t" for a tab, "\n" for a
 newline, "\r" for a carriage return and "\a" for a bell (or alert).  If
 your string is better thought of as a sequence of arbitrary bytes, the
 octal escape sequence, _e_._g_., "\033", or hexadecimal escape sequence,
 _e_._g_., "\x1B" may be a more natural representation for your bytes.  Here
 are some examples of escapes:

     "1000\t2000" =~ m(0\t2)   # matches
     "1000\n2000" =~ /0\n20/   # matches
     "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
     "cat"   =~ /\o{143}\x61\x74/ # matches in ASCII, but a weird way
                                  # to spell cat

 If you've been around Perl a while, all this talk of escape sequences may
 seem familiar.  Similar escape sequences are used in double-quoted
 strings and in fact the regexps in Perl are mostly treated as double-
 quoted strings.  This means that variables can be used in regexps as
 well.  Just like double-quoted strings, the values of the variables in
 the regexp will be substituted in before the regexp is evaluated for
 matching purposes.  So we have:

     $foo = 'house';
     'housecat' =~ /$foo/;      # matches
     'cathouse' =~ /cat$foo/;   # matches
     'housecat' =~ /${foo}cat/; # matches

 So far, so good.  With the knowledge above you can already perform
 searches with just about any literal string regexp you can dream up.
 Here is a _v_e_r_y _s_i_m_p_l_e emulation of the Unix grep program:

     % cat > simple_grep
     #!/usr/bin/perl
     $regexp = shift;
     while (<>) {
         print if /$regexp/;
     }

^D #

     % chmod +x simple_grep

     % simple_grep abba /usr/dict/words
     Babbage
     cabbage
     cabbages
     sabbath
     Sabbathize
     Sabbathizes
     sabbatical
     scabbard
     scabbards

 This program is easy to understand.  "#!/usr/bin/perl" is the standard
 way to invoke a perl program from the shell.  "$regexp = shift;" saves
 the first command line argument as the regexp to be used, leaving the
 rest of the command line arguments to be treated as files.  "while (<>)"
 loops over all the lines in all the files.  For each line,
 "print if /$regexp/;" prints the line if the regexp matches the line.  In
 this line, both "print" and "/$regexp/" use the default variable $_
 implicitly.

 With all of the regexps above, if the regexp matched anywhere in the
 string, it was considered a match.  Sometimes, however, we'd like to
 specify _w_h_e_r_e in the string the regexp should try to match.  To do this,
 we would use the _a_n_c_h_o_r metacharacters '^' and '$'.  The anchor '^' means
 match at the beginning of the string and the anchor '$' means match at
 the end of the string, or before a newline at the end of the string.
 Here is how they are used:

     "housekeeper" =~ /keeper/;    # matches
     "housekeeper" =~ /^keeper/;   # doesn't match
     "housekeeper" =~ /keeper$/;   # matches
     "housekeeper\n" =~ /keeper$/; # matches

 The second regexp doesn't match because '^' constrains "keeper" to match
 only at the beginning of the string, but "housekeeper" has keeper
 starting in the middle.  The third regexp does match, since the '$'
 constrains "keeper" to match only at the end of the string.

 When both '^' and '$' are used at the same time, the regexp has to match
 both the beginning and the end of the string, _i_._e_., the regexp matches
 the whole string.  Consider

     "keeper" =~ /^keep$/;      # doesn't match
     "keeper" =~ /^keeper$/;    # matches
     ""       =~ /^$/;          # ^$ matches an empty string

 The first regexp doesn't match because the string has more to it than
 "keep".  Since the second regexp is exactly the string, it matches.
 Using both '^' and '$' in a regexp forces the complete string to match,
 so it gives you complete control over which strings match and which
 don't.  Suppose you are looking for a fellow named bert, off in a string
 by himself:

     "dogbert" =~ /bert/;   # matches, but not what you want

     "dilbert" =~ /^bert/;  # doesn't match, but ..
     "bertram" =~ /^bert/;  # matches, so still not good enough

     "bertram" =~ /^bert$/; # doesn't match, good
     "dilbert" =~ /^bert$/; # doesn't match, good
     "bert"    =~ /^bert$/; # matches, perfect

 Of course, in the case of a literal string, one could just as easily use
 the string comparison "$string eq 'bert'" and it would be more efficient.
 The  "^...$" regexp really becomes useful when we add in the more
 powerful regexp tools below.

UUssiinngg cchhaarraacctteerr ccllaasssseess Although one can already do quite a lot with the literal string regexps above, we’ve only scratched the surface of regular expression technology. In this and subsequent sections we will introduce regexp concepts (and associated metacharacter notations) that will allow a regexp to represent not just a single character sequence, but a _w_h_o_l_e _c_l_a_s_s of them.

 One such concept is that of a _c_h_a_r_a_c_t_e_r _c_l_a_s_s.  A character class allows
 a set of possible characters, rather than just a single character, to
 match at a particular point in a regexp.  You can define your own custom
 character classes.  These are denoted by brackets "[...]", with the set
 of characters to be possibly matched inside.  Here are some examples:

     /cat/;       # matches 'cat'
     /[bcr]at/;   # matches 'bat, 'cat', or 'rat'
     /item[0123456789]/;  # matches 'item0' or ... or 'item9'
     "abc" =~ /[cab]/;    # matches 'a'

 In the last statement, even though 'c' is the first character in the
 class, 'a' matches because the first character position in the string is
 the earliest point at which the regexp can match.

     /[yY][eE][sS]/;      # match 'yes' in a case-insensitive way
                          # 'yes', 'Yes', 'YES', etc.

 This regexp displays a common task: perform a case-insensitive match.
 Perl provides a way of avoiding all those brackets by simply appending an
 'i' to the end of the match.  Then "/[yY][eE][sS]/;" can be rewritten as
 "/yes/i;".  The 'i' stands for case-insensitive and is an example of a
 _m_o_d_i_f_i_e_r of the matching operation.  We will meet other modifiers later
 in the tutorial.

 We saw in the section above that there were ordinary characters, which
 represented themselves, and special characters, which needed a backslash
 '\' to represent themselves.  The same is true in a character class, but
 the sets of ordinary and special characters inside a character class are
 different than those outside a character class.  The special characters
 for a character class are "-]\^$" (and the pattern delimiter, whatever it
 is).  ']' is special because it denotes the end of a character class.
 '$' is special because it denotes a scalar variable.  '\' is special
 because it is used in escape sequences, just like above.  Here is how the
 special characters "]$\" are handled:

    /[\]c]def/; # matches ']def' or 'cdef'
    $x = 'bcr';
    /[$x]at/;   # matches 'bat', 'cat', or 'rat'
    /[\$x]at/;  # matches '$at' or 'xat'
    /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'

 The last two are a little tricky.  In "[\$x]", the backslash protects the
 dollar sign, so the character class has two members '$' and 'x'.  In
 "[\\$x]", the backslash is protected, so $x is treated as a variable and
 substituted in double quote fashion.

 The special character '-' acts as a range operator within character
 classes, so that a contiguous set of characters can be written as a
 range.  With ranges, the unwieldy "[0123456789]" and "[abc...xyz]" become
 the svelte "[0-9]" and "[a-z]".  Some examples are

     /item[0-9]/;  # matches 'item0' or ... or 'item9'
     /[0-9bx-z]aa/;  # matches '0aa', ..., '9aa',
                     # 'baa', 'xaa', 'yaa', or 'zaa'
     /[0-9a-fA-F]/;  # matches a hexadecimal digit
     /[0-9a-zA-Z_]/; # matches a "word" character,
                     # like those in a Perl variable name

 If '-' is the first or last character in a character class, it is treated
 as an ordinary character; "[-ab]", "[ab-]" and "[a\-b]" are all
 equivalent.

 The special character '^' in the first position of a character class
 denotes a _n_e_g_a_t_e_d _c_h_a_r_a_c_t_e_r _c_l_a_s_s, which matches any character but those
 in the brackets.  Both "[...]" and "[^...]" must match a character, or
 the match fails.  Then

     /[^a]at/;  # doesn't match 'aat' or 'at', but matches
                # all other 'bat', 'cat, '0at', '%at', etc.
     /[^0-9]/;  # matches a non-numeric character
     /[a^]at/;  # matches 'aat' or '^at'; here '^' is ordinary

 Now, even "[0-9]" can be a bother to write multiple times, so in the
 interest of saving keystrokes and making regexps more readable, Perl has
 several abbreviations for common character classes, as shown below.
 Since the introduction of Unicode, unless the "/a" modifier is in effect,
 these character classes match more than just a few characters in the
 ASCII range.

 •   "\d" matches a digit, not just "[0-9]" but also digits from non-roman
     scripts

 •   "\s" matches a whitespace character, the set "[\ \t\r\n\f]" and
     others

 •   "\w" matches a word character (alphanumeric or '_'), not just
     "[0-9a-zA-Z_]" but also digits and characters from non-roman scripts

 •   "\D" is a negated "\d"; it represents any other character than a
     digit, or "[^\d]"

 •   "\S" is a negated "\s"; it represents any non-whitespace character
     "[^\s]"

 •   "\W" is a negated "\w"; it represents any non-word character "[^\w]"

 •   The period '.' matches any character but "\n" (unless the modifier
     "/s" is in effect, as explained below).

 •   "\N", like the period, matches any character but "\n", but it does so
     regardless of whether the modifier "/s" is in effect.

 The "/a" modifier, available starting in Perl 5.14,  is used to restrict
 the matches of "\d", "\s", and "\w" to just those in the ASCII range.  It
 is useful to keep your program from being needlessly exposed to full
 Unicode (and its accompanying security considerations) when all you want
 is to process English-like text.  (The "a" may be doubled, "/aa", to
 provide even more restrictions, preventing case-insensitive matching of
 ASCII with non-ASCII characters; otherwise a Unicode "Kelvin Sign" would
 caselessly match a "k" or "K".)

 The "\d\s\w\D\S\W" abbreviations can be used both inside and outside of
 bracketed character classes.  Here are some in use:

     /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
     /[\d\s]/;         # matches any digit or whitespace character
     /\w\W\w/;         # matches a word char, followed by a
                       # non-word char, followed by a word char
     /..rt/;           # matches any two chars, followed by 'rt'
     /end\./;          # matches 'end.'
     /end[.]/;         # same thing, matches 'end.'

 Because a period is a metacharacter, it needs to be escaped to match as
 an ordinary period. Because, for example, "\d" and "\w" are sets of
 characters, it is incorrect to think of "[^\d\w]" as "[\D\W]"; in fact
 "[^\d\w]" is the same as "[^\w]", which is the same as "[\W]". Think De
 Morgan's laws.

 In actuality, the period and "\d\s\w\D\S\W" abbreviations are themselves
 types of character classes, so the ones surrounded by brackets are just
 one type of character class.  When we need to make a distinction, we
 refer to them as "bracketed character classes."

 An anchor useful in basic regexps is the _w_o_r_d _a_n_c_h_o_r "\b".  This matches
 a boundary between a word character and a non-word character "\w\W" or
 "\W\w":

     $x = "Housecat catenates house and cat";
     $x =~ /cat/;    # matches cat in 'housecat'
     $x =~ /\bcat/;  # matches cat in 'catenates'
     $x =~ /cat\b/;  # matches cat in 'housecat'
     $x =~ /\bcat\b/;  # matches 'cat' at end of string

 Note in the last example, the end of the string is considered a word
 boundary.

 For natural language processing (so that, for example, apostrophes are
 included in words), use instead "\b{wb}"

     "don't" =~ / .+? \b{wb} /x;  # matches the whole string

 You might wonder why '.' matches everything but "\n" - why not every
 character? The reason is that often one is matching against lines and
 would like to ignore the newline characters.  For instance, while the
 string "\n" represents one line, we would like to think of it as empty.
 Then

     ""   =~ /^$/;    # matches
     "\n" =~ /^$/;    # matches, $ anchors before "\n"

     ""   =~ /./;      # doesn't match; it needs a char
     ""   =~ /^.$/;    # doesn't match; it needs a char
     "\n" =~ /^.$/;    # doesn't match; it needs a char other than "\n"
     "a"  =~ /^.$/;    # matches
     "a\n"  =~ /^.$/;  # matches, $ anchors before "\n"

 This behavior is convenient, because we usually want to ignore newlines
 when we count and match characters in a line.  Sometimes, however, we
 want to keep track of newlines.  We might even want '^' and '$' to anchor
 at the beginning and end of lines within the string, rather than just the
 beginning and end of the string.  Perl allows us to choose between
 ignoring and paying attention to newlines by using the "/s" and "/m"
 modifiers.  "/s" and "/m" stand for single line and multi-line and they
 determine whether a string is to be treated as one continuous string, or
 as a set of lines.  The two modifiers affect two aspects of how the
 regexp is interpreted: 1) how the '.' character class is defined, and 2)
 where the anchors '^' and '$' are able to match.  Here are the four
 possible combinations:

 •   no modifiers: Default behavior.  '.' matches any character except
     "\n".  '^' matches only at the beginning of the string and '$'
     matches only at the end or before a newline at the end.

 •   s modifier ("/s"): Treat string as a single long line.  '.' matches
     any character, even "\n".  '^' matches only at the beginning of the
     string and '$' matches only at the end or before a newline at the
     end.

 •   m modifier ("/m"): Treat string as a set of multiple lines.  '.'
     matches any character except "\n".  '^' and '$' are able to match at
     the start or end of _a_n_y line within the string.

 •   both s and m modifiers ("/sm"): Treat string as a single long line,
     but detect multiple lines.  '.' matches any character, even "\n".
     '^' and '$', however, are able to match at the start or end of _a_n_y
     line within the string.

 Here are examples of "/s" and "/m" in action:

     $x = "There once was a girl\nWho programmed in Perl\n";

     $x =~ /^Who/;   # doesn't match, "Who" not at start of string
     $x =~ /^Who/s;  # doesn't match, "Who" not at start of string
     $x =~ /^Who/m;  # matches, "Who" at start of second line
     $x =~ /^Who/sm; # matches, "Who" at start of second line

     $x =~ /girl.Who/;   # doesn't match, "." doesn't match "\n"
     $x =~ /girl.Who/s;  # matches, "." matches "\n"
     $x =~ /girl.Who/m;  # doesn't match, "." doesn't match "\n"
     $x =~ /girl.Who/sm; # matches, "." matches "\n"

 Most of the time, the default behavior is what is wanted, but "/s" and
 "/m" are occasionally very useful.  If "/m" is being used, the start of
 the string can still be matched with "\A" and the end of the string can
 still be matched with the anchors "\Z" (matches both the end and the
 newline before, like '$'), and "\z" (matches only the end):

     $x =~ /^Who/m;   # matches, "Who" at start of second line
     $x =~ /\AWho/m;  # doesn't match, "Who" is not at start of string

     $x =~ /girl$/m;  # matches, "girl" at end of first line
     $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string

     $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
     $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string

 We now know how to create choices among classes of characters in a
 regexp.  What about choices among words or character strings? Such
 choices are described in the next section.

MMaattcchhiinngg tthhiiss oorr tthhaatt Sometimes we would like our regexp to be able to match different possible words or character strings. This is accomplished by using the _a_l_t_e_r_n_a_t_i_o_n metacharacter ‘|’. To match “dog” or “cat”, we form the regexp “dog|cat”. As before, Perl will try to match the regexp at the earliest possible point in the string. At each character position, Perl will first try to match the first alternative, “dog”. If “dog” doesn’t match, Perl will then try the next alternative, “cat”. If “cat” doesn’t match either, then the match fails and Perl moves to the next position in the string. Some examples:

     "cats and dogs" =~ /cat|dog|bird/;  # matches "cat"
     "cats and dogs" =~ /dog|cat|bird/;  # matches "cat"

 Even though "dog" is the first alternative in the second regexp, "cat" is
 able to match earlier in the string.

     "cats"          =~ /c|ca|cat|cats/; # matches "c"
     "cats"          =~ /cats|cat|ca|c/; # matches "cats"

 Here, all the alternatives match at the first string position, so the
 first alternative is the one that matches.  If some of the alternatives
 are truncations of the others, put the longest ones first to give them a
 chance to match.

     "cab" =~ /a|b|c/ # matches "c"
                      # /a|b|c/ == /[abc]/

 The last example points out that character classes are like alternations
 of characters.  At a given character position, the first alternative that
 allows the regexp match to succeed will be the one that matches.

GGrroouuppiinngg tthhiinnggss aanndd hhiieerraarrcchhiiccaall mmaattcchhiinngg Alternation allows a regexp to choose among alternatives, but by itself it is unsatisfying. The reason is that each alternative is a whole regexp, but sometime we want alternatives for just part of a regexp. For instance, suppose we want to search for housecats or housekeepers. The regexp “housecat|housekeeper” fits the bill, but is inefficient because we had to type “house” twice. It would be nice to have parts of the regexp be constant, like “house”, and some parts have alternatives, like “cat|keeper”.

 The _g_r_o_u_p_i_n_g metacharacters "()" solve this problem.  Grouping allows
 parts of a regexp to be treated as a single unit.  Parts of a regexp are
 grouped by enclosing them in parentheses.  Thus we could solve the
 "housecat|housekeeper" by forming the regexp as "house(cat|keeper)".  The
 regexp "house(cat|keeper)" means match "house" followed by either "cat"
 or "keeper".  Some more examples are

     /(a|b)b/;    # matches 'ab' or 'bb'
     /(ac|b)b/;   # matches 'acb' or 'bb'
     /(^a|b)c/;   # matches 'ac' at start of string or 'bc' anywhere
     /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'

     /house(cat|)/;  # matches either 'housecat' or 'house'
     /house(cat(s|)|)/;  # matches either 'housecats' or 'housecat' or
                         # 'house'.  Note groups can be nested.

     /(19|20|)\d\d/;  # match years 19xx, 20xx, or the Y2K problem, xx
     "20" =~ /(19|20|)\d\d/;  # matches the null alternative '()\d\d',
                              # because '20\d\d' can't match

 Alternations behave the same way in groups as out of them: at a given
 string position, the leftmost alternative that allows the regexp to match
 is taken.  So in the last example at the first string position, "20"
 matches the second alternative, but there is nothing left over to match
 the next two digits "\d\d".  So Perl moves on to the next alternative,
 which is the null alternative and that works, since "20" is two digits.

 The process of trying one alternative, seeing if it matches, and moving
 on to the next alternative, while going back in the string from where the
 previous alternative was tried, if it doesn't, is called _b_a_c_k_t_r_a_c_k_i_n_g.
 The term "backtracking" comes from the idea that matching a regexp is
 like a walk in the woods.  Successfully matching a regexp is like
 arriving at a destination.  There are many possible trailheads, one for
 each string position, and each one is tried in order, left to right.
 From each trailhead there may be many paths, some of which get you there,
 and some which are dead ends.  When you walk along a trail and hit a dead
 end, you have to backtrack along the trail to an earlier point to try
 another trail.  If you hit your destination, you stop immediately and
 forget about trying all the other trails.  You are persistent, and only
 if you have tried all the trails from all the trailheads and not arrived
 at your destination, do you declare failure.  To be concrete, here is a
 step-by-step analysis of what Perl does when it tries to match the regexp

     "abcde" =~ /(abd|abc)(df|d|de)/;

 0. Start with the first letter in the string 'a'.
      

 1. Try the first alternative in the first group 'abd'.
      

 2.  Match 'a' followed by 'b'. So far so good.
      

 3.  'd' in the regexp doesn't match 'c' in the string - a dead end.  So
 backtrack two characters and pick the second alternative in the first
 group 'abc'.
      

 4.  Match 'a' followed by 'b' followed by 'c'.  We are on a roll and have
 satisfied the first group. Set $1 to 'abc'.
      

 5 Move on to the second group and pick the first alternative 'df'.
      

 6 Match the 'd'.
      

 7.  'f' in the regexp doesn't match 'e' in the string, so a dead end.
 Backtrack one character and pick the second alternative in the second
 group 'd'.
      

 8.  'd' matches. The second grouping is satisfied, so set $2 to 'd'.
      

 9.  We are at the end of the regexp, so we are done! We have matched
 'abcd' out of the string "abcde".

 There are a couple of things to note about this analysis.  First, the
 third alternative in the second group 'de' also allows a match, but we
 stopped before we got to it - at a given character position, leftmost
 wins.  Second, we were able to get a match at the first character
 position of the string 'a'.  If there were no matches at the first
 position, Perl would move to the second character position 'b' and
 attempt the match all over again.  Only when all possible paths at all
 possible character positions have been exhausted does Perl give up and
 declare "$string =~ /(abd|abc)(df|d|de)/;" to be false.

 Even with all this work, regexp matching happens remarkably fast.  To
 speed things up, Perl compiles the regexp into a compact sequence of
 opcodes that can often fit inside a processor cache.  When the code is
 executed, these opcodes can then run at full throttle and search very
 quickly.

EExxttrraaccttiinngg mmaattcchheess The grouping metacharacters “()” also serve another completely different function: they allow the extraction of the parts of a string that matched. This is very useful to find out what matched and for text processing in general. For each grouping, the part that matched inside goes into the special variables $1, $2, _e_t_c. They can be used just as ordinary variables:

     # extract hours, minutes, seconds
     if ($time =~ /(\d\d):(\d\d):(\d\d)/) {    # match hh:mm:ss format
         $hours = $1;
         $minutes = $2;
         $seconds = $3;
     }

 Now, we know that in scalar context, "$time =~ /(\d\d):(\d\d):(\d\d)/"
 returns a true or false value.  In list context, however, it returns the
 list of matched values "($1,$2,$3)".  So we could write the code more
 compactly as

     # extract hours, minutes, seconds
     ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);

 If the groupings in a regexp are nested, $1 gets the group with the
 leftmost opening parenthesis, $2 the next opening parenthesis, _e_t_c.  Here
 is a regexp with nested groups:

     /(ab(cd|ef)((gi)|j))/;
      1  2      34

 If this regexp matches, $1 contains a string starting with 'ab', $2 is
 either set to 'cd' or 'ef', $3 equals either 'gi' or 'j', and $4 is
 either set to 'gi', just like $3, or it remains undefined.

 For convenience, Perl sets $+ to the string held by the highest numbered
 $1, $2,... that got assigned (and, somewhat related, $^N to the value of
 the $1, $2,... most-recently assigned; _i_._e_. the $1, $2,... associated
 with the rightmost closing parenthesis used in the match).

BBaacckkrreeffeerreenncceess Closely associated with the matching variables $1, $2, … are the _b_a_c_k_r_e_f_e_r_e_n_c_e_s “\g1”, “\g2”,… Backreferences are simply matching variables that can be used _i_n_s_i_d_e a regexp. This is a really nice feature; what matches later in a regexp is made to depend on what matched earlier in the regexp. Suppose we wanted to look for doubled words in a text, like “the the”. The following regexp finds all 3-letter doubles with a space in between:

     /\b(\w\w\w)\s\g1\b/;

 The grouping assigns a value to "\g1", so that the same 3-letter sequence
 is used for both parts.

 A similar task is to find words consisting of two identical parts:

     % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\g1$' /usr/dict/words
     beriberi
     booboo
     coco
     mama
     murmur
     papa

 The regexp has a single grouping which considers 4-letter combinations,
 then 3-letter combinations, _e_t_c., and uses "\g1" to look for a repeat.
 Although $1 and "\g1" represent the same thing, care should be taken to
 use matched variables $1, $2,... only _o_u_t_s_i_d_e a regexp and backreferences
 "\g1", "\g2",... only _i_n_s_i_d_e a regexp; not doing so may lead to
 surprising and unsatisfactory results.

RReellaattiivvee bbaacckkrreeffeerreenncceess Counting the opening parentheses to get the correct number for a backreference is error-prone as soon as there is more than one capturing group. A more convenient technique became available with Perl 5.10: relative backreferences. To refer to the immediately preceding capture group one now may write “\g-1” or “\g{-1}”, the next but last is available via “\g-2” or “\g{-2}”, and so on.

 Another good reason in addition to readability and maintainability for
 using relative backreferences is illustrated by the following example,
 where a simple pattern for matching peculiar strings is used:

     $a99a = '([a-z])(\d)\g2\g1';   # matches a11a, g22g, x33x, etc.

 Now that we have this pattern stored as a handy string, we might feel
 tempted to use it as a part of some other pattern:

     $line = "code=e99e";
     if ($line =~ /^(\w+)=$a99a$/){   # unexpected behavior!
         print "$1 is valid\n";
     } else {
         print "bad line: '$line'\n";
     }

 But this doesn't match, at least not the way one might expect. Only after
 inserting the interpolated $a99a and looking at the resulting full text
 of the regexp is it obvious that the backreferences have backfired. The
 subexpression "(\w+)" has snatched number 1 and demoted the groups in
 $a99a by one rank. This can be avoided by using relative backreferences:

     $a99a = '([a-z])(\d)\g{-1}\g{-2}';  # safe for being interpolated

NNaammeedd bbaacckkrreeffeerreenncceess Perl 5.10 also introduced named capture groups and named backreferences. To attach a name to a capturing group, you write either “(?…)” or “(?’name’…)”. The backreference may then be written as “\g{name}”. It is permissible to attach the same name to more than one group, but then only the leftmost one of the eponymous set can be referenced. Outside of the pattern a named capture group is accessible through the “%+” hash.

 Assuming that we have to match calendar dates which may be given in one
 of the three formats yyyy-mm-dd, mm/dd/yyyy or dd.mm.yyyy, we can write
 three suitable patterns where we use 'd', 'm' and 'y' respectively as the
 names of the groups capturing the pertaining components of a date. The
 matching operation combines the three patterns as alternatives:

     $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
     $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
     $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
     for my $d (qw(2006-10-21 15.01.2007 10/31/2005)) {
         if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
             print "day=$+{d} month=$+{m} year=$+{y}\n";
         }
     }

 If any of the alternatives matches, the hash "%+" is bound to contain the
 three key-value pairs.

AAlltteerrnnaattiivvee ccaappttuurree ggrroouupp nnuummbbeerriinngg Yet another capturing group numbering technique (also as from Perl 5.10) deals with the problem of referring to groups within a set of alternatives. Consider a pattern for matching a time of the day, civil or military style:

     if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
         # process hour and minute
     }

 Processing the results requires an additional if statement to determine
 whether $1 and $2 or $3 and $4 contain the goodies. It would be easier if
 we could use group numbers 1 and 2 in second alternative as well, and
 this is exactly what the parenthesized construct "(?|...)", set around an
 alternative achieves. Here is an extended version of the previous
 pattern:

   if($time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/){
       print "hour=$1 minute=$2 zone=$3\n";
   }

 Within the alternative numbering group, group numbers start at the same
 position for each alternative. After the group, numbering continues with
 one higher than the maximum reached across all the alternatives.

PPoossiittiioonn iinnffoorrmmaattiioonn In addition to what was matched, Perl also provides the positions of what was matched as contents of the “@-” and “@+” arrays. “$-[0]” is the position of the start of the entire match and $+[0] is the position of the end. Similarly, “$-[n]” is the position of the start of the $n match and $+[n] is the position of the end. If $n is undefined, so are “$-[n]” and $+[n]. Then this code

     $x = "Mmm...donut, thought Homer";
     $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
     foreach $exp (1..$#-) {
         no strict 'refs';
         print "Match $exp: '$$exp' at position ($-[$exp],$+[$exp])\n";
     }

 prints

     Match 1: 'Mmm' at position (0,3)
     Match 2: 'donut' at position (6,11)

 Even if there are no groupings in a regexp, it is still possible to find
 out what exactly matched in a string.  If you use them, Perl will set
 "$`" to the part of the string before the match, will set $& to the part
 of the string that matched, and will set "$'" to the part of the string
 after the match.  An example:

     $x = "the cat caught the mouse";
     $x =~ /cat/;  # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
     $x =~ /the/;  # $` = '', $& = 'the', $' = ' cat caught the mouse'

 In the second match, "$`" equals '' because the regexp matched at the
 first character position in the string and stopped; it never saw the
 second "the".

 If your code is to run on Perl versions earlier than 5.20, it is
 worthwhile to note that using "$`" and "$'" slows down regexp matching
 quite a bit, while $& slows it down to a lesser extent, because if they
 are used in one regexp in a program, they are generated for _a_l_l regexps
 in the program.  So if raw performance is a goal of your application,
 they should be avoided.  If you need to extract the corresponding
 substrings, use "@-" and "@+" instead:

     $` is the same as substr( $x, 0, $-[0] )
     $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
     $' is the same as substr( $x, $+[0] )

 As of Perl 5.10, the "${^PREMATCH}", "${^MATCH}" and "${^POSTMATCH}"
 variables may be used.  These are only set if the "/p" modifier is
 present.  Consequently they do not penalize the rest of the program.  In
 Perl 5.20, "${^PREMATCH}", "${^MATCH}" and "${^POSTMATCH}" are available
 whether the "/p" has been used or not (the modifier is ignored), and
 "$`", "$'" and $& do not cause any speed difference.

NNoonn--ccaappttuurriinngg ggrroouuppiinnggss A group that is required to bundle a set of alternatives may or may not be useful as a capturing group. If it isn’t, it just creates a superfluous addition to the set of available capture group values, inside as well as outside the regexp. Non-capturing groupings, denoted by “(?:regexp)”, still allow the regexp to be treated as a single unit, but don’t establish a capturing group at the same time. Both capturing and non-capturing groupings are allowed to co-exist in the same regexp. Because there is no extraction, non-capturing groupings are faster than capturing groupings. Non-capturing groupings are also handy for choosing exactly which parts of a regexp are to be extracted to matching variables:

     # match a number, $1-$4 are set, but we only want $1
     /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;

     # match a number faster , only $1 is set
     /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;

     # match a number, get $1 = whole number, $2 = exponent
     /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;

 Non-capturing groupings are also useful for removing nuisance elements
 gathered from a split operation where parentheses are required for some
 reason:

     $x = '12aba34ba5';
     @num = split /(a|b)+/, $x;    # @num = ('12','a','34','a','5')
     @num = split /(?:a|b)+/, $x;  # @num = ('12','34','5')

 In Perl 5.22 and later, all groups within a regexp can be set to non-
 capturing by using the new "/n" flag:

     "hello" =~ /(hi|hello)/n; # $1 is not set!

 See "n" in perlre for more information.

MMaattcchhiinngg rreeppeettiittiioonnss The examples in the previous section display an annoying weakness. We were only matching 3-letter words, or chunks of words of 4 letters or less. We’d like to be able to match words or, more generally, strings of any length, without writing out tedious alternatives like “\w\w\w\w|\w\w\w|\w\w|\w”.

 This is exactly the problem the _q_u_a_n_t_i_f_i_e_r metacharacters '?', '*', '+',
 and "{}" were created for.  They allow us to delimit the number of
 repeats for a portion of a regexp we consider to be a match.  Quantifiers
 are put immediately after the character, character class, or grouping
 that we want to specify.  They have the following meanings:

 •   "a?" means: match 'a' 1 or 0 times

 •   "a*" means: match 'a' 0 or more times, _i_._e_., any number of times

 •   "a+" means: match 'a' 1 or more times, _i_._e_., at least once

 •   "a{n,m}" means: match at least "n" times, but not more than "m"
     times.

 •   "a{n,}" means: match at least "n" or more times

 •   "a{,n}" means: match at most "n" times, or fewer

 •   "a{n}" means: match exactly "n" times

 If you like, you can add blanks (tab or space characters) within the
 braces, but adjacent to them, and/or next to the comma (if any).

 Here are some examples:

     /[a-z]+\s+\d*/;  # match a lowercase word, at least one space, and
                      # any number of digits
     /(\w+)\s+\g1/;    # match doubled words of arbitrary length
     /y(es)?/i;       # matches 'y', 'Y', or a case-insensitive 'yes'
     $year =~ /^\d{2,4}$/;  # make sure year is at least 2 but not more
                            # than 4 digits
     $year =~ /^\d{ 2, 4 }$/;    # Same; for those who like wide open
                                 # spaces.
     $year =~ /^\d{2, 4}$/;      # Same.
     $year =~ /^\d{4}$|^\d{2}$/; # better match; throw out 3-digit dates
     $year =~ /^\d{2}(\d{2})?$/; # same thing written differently.
                                 # However, this captures the last two
                                 # digits in $1 and the other does not.

     % simple_grep '^(\w+)\g1$' /usr/dict/words   # isn't this easier?
     beriberi
     booboo
     coco
     mama
     murmur
     papa

 For all of these quantifiers, Perl will try to match as much of the
 string as possible, while still allowing the regexp to succeed.  Thus
 with "/a?.../", Perl will first try to match the regexp with the 'a'
 present; if that fails, Perl will try to match the regexp without the 'a'
 present.  For the quantifier '*', we get the following:

     $x = "the cat in the hat";
     $x =~ /^(.*)(cat)(.*)$/; # matches,
                              # $1 = 'the '
                              # $2 = 'cat'
                              # $3 = ' in the hat'

 Which is what we might expect, the match finds the only "cat" in the
 string and locks onto it.  Consider, however, this regexp:

     $x =~ /^(.*)(at)(.*)$/; # matches,
                             # $1 = 'the cat in the h'
                             # $2 = 'at'
                             # $3 = ''   (0 characters match)

 One might initially guess that Perl would find the "at" in "cat" and stop
 there, but that wouldn't give the longest possible string to the first
 quantifier ".*".  Instead, the first quantifier ".*" grabs as much of the
 string as possible while still having the regexp match.  In this example,
 that means having the "at" sequence with the final "at" in the string.
 The other important principle illustrated here is that, when there are
 two or more elements in a regexp, the _l_e_f_t_m_o_s_t quantifier, if there is
 one, gets to grab as much of the string as possible, leaving the rest of
 the regexp to fight over scraps.  Thus in our example, the first
 quantifier ".*" grabs most of the string, while the second quantifier
 ".*" gets the empty string.   Quantifiers that grab as much of the string
 as possible are called _m_a_x_i_m_a_l _m_a_t_c_h or _g_r_e_e_d_y quantifiers.

 When a regexp can match a string in several different ways, we can use
 the principles above to predict which way the regexp will match:

 •   Principle 0: Taken as a whole, any regexp will be matched at the
     earliest possible position in the string.

 •   Principle 1: In an alternation "a|b|c...", the leftmost alternative
     that allows a match for the whole regexp will be the one used.

 •   Principle 2: The maximal matching quantifiers '?', '*', '+' and
     "{n,m}" will in general match as much of the string as possible while
     still allowing the whole regexp to match.

 •   Principle 3: If there are two or more elements in a regexp, the
     leftmost greedy quantifier, if any, will match as much of the string
     as possible while still allowing the whole regexp to match.  The next
     leftmost greedy quantifier, if any, will try to match as much of the
     string remaining available to it as possible, while still allowing
     the whole regexp to match.  And so on, until all the regexp elements
     are satisfied.

 As we have seen above, Principle 0 overrides the others. The regexp will
 be matched as early as possible, with the other principles determining
 how the regexp matches at that earliest character position.

 Here is an example of these principles in action:

     $x = "The programming republic of Perl";
     $x =~ /^(.+)(e|r)(.*)$/;  # matches,
                               # $1 = 'The programming republic of Pe'
                               # $2 = 'r'
                               # $3 = 'l'

 This regexp matches at the earliest string position, 'T'.  One might
 think that 'e', being leftmost in the alternation, would be matched, but
 'r' produces the longest string in the first quantifier.

     $x =~ /(m{1,2})(.*)$/;  # matches,
                             # $1 = 'mm'
                             # $2 = 'ing republic of Perl'

 Here, The earliest possible match is at the first 'm' in "programming".
 "m{1,2}" is the first quantifier, so it gets to match a maximal "mm".

     $x =~ /.*(m{1,2})(.*)$/;  # matches,
                               # $1 = 'm'
                               # $2 = 'ing republic of Perl'

 Here, the regexp matches at the start of the string. The first quantifier
 ".*" grabs as much as possible, leaving just a single 'm' for the second
 quantifier "m{1,2}".

     $x =~ /(.?)(m{1,2})(.*)$/;  # matches,
                                 # $1 = 'a'
                                 # $2 = 'mm'
                                 # $3 = 'ing republic of Perl'

 Here, ".?" eats its maximal one character at the earliest possible
 position in the string, 'a' in "programming", leaving "m{1,2}" the
 opportunity to match both 'm''s. Finally,

     "aXXXb" =~ /(X*)/; # matches with $1 = ''

 because it can match zero copies of 'X' at the beginning of the string.
 If you definitely want to match at least one 'X', use "X+", not "X*".

 Sometimes greed is not good.  At times, we would like quantifiers to
 match a _m_i_n_i_m_a_l piece of string, rather than a maximal piece.  For this
 purpose, Larry Wall created the _m_i_n_i_m_a_l _m_a_t_c_h or _n_o_n_-_g_r_e_e_d_y quantifiers
 "??", "*?", "+?", and "{}?".  These are the usual quantifiers with a '?'
 appended to them.  They have the following meanings:

 •   "a??" means: match 'a' 0 or 1 times. Try 0 first, then 1.

 •   "a*?" means: match 'a' 0 or more times, _i_._e_., any number of times,
     but as few times as possible

 •   "a+?" means: match 'a' 1 or more times, _i_._e_., at least once, but as
     few times as possible

 •   "a{n,m}?" means: match at least "n" times, not more than "m" times,
     as few times as possible

 •   "a{n,}?" means: match at least "n" times, but as few times as
     possible

 •   "a{,n}?" means: match at most "n" times, but as few times as possible

 •   "a{n}?" means: match exactly "n" times.  Because we match exactly "n"
     times, "a{n}?" is equivalent to "a{n}" and is just there for
     notational consistency.

 Let's look at the example above, but with minimal quantifiers:

     $x = "The programming republic of Perl";
     $x =~ /^(.+?)(e|r)(.*)$/; # matches,
                               # $1 = 'Th'
                               # $2 = 'e'
                               # $3 = ' programming republic of Perl'

 The minimal string that will allow both the start of the string '^' and
 the alternation to match is "Th", with the alternation "e|r" matching
 'e'.  The second quantifier ".*" is free to gobble up the rest of the
 string.

     $x =~ /(m{1,2}?)(.*?)$/;  # matches,
                               # $1 = 'm'
                               # $2 = 'ming republic of Perl'

 The first string position that this regexp can match is at the first 'm'
 in "programming". At this position, the minimal "m{1,2}?" matches just
 one 'm'.  Although the second quantifier ".*?" would prefer to match no
 characters, it is constrained by the end-of-string anchor '$' to match
 the rest of the string.

     $x =~ /(.*?)(m{1,2}?)(.*)$/;  # matches,
                                   # $1 = 'The progra'
                                   # $2 = 'm'
                                   # $3 = 'ming republic of Perl'

 In this regexp, you might expect the first minimal quantifier ".*?" to
 match the empty string, because it is not constrained by a '^' anchor to
 match the beginning of the word.  Principle 0 applies here, however.
 Because it is possible for the whole regexp to match at the start of the
 string, it _w_i_l_l match at the start of the string.  Thus the first
 quantifier has to match everything up to the first 'm'.  The second
 minimal quantifier matches just one 'm' and the third quantifier matches
 the rest of the string.

     $x =~ /(.??)(m{1,2})(.*)$/;  # matches,
                                  # $1 = 'a'
                                  # $2 = 'mm'
                                  # $3 = 'ing republic of Perl'

 Just as in the previous regexp, the first quantifier ".??" can match
 earliest at position 'a', so it does.  The second quantifier is greedy,
 so it matches "mm", and the third matches the rest of the string.

 We can modify principle 3 above to take into account non-greedy
 quantifiers:

 •   Principle 3: If there are two or more elements in a regexp, the
     leftmost greedy (non-greedy) quantifier, if any, will match as much
     (little) of the string as possible while still allowing the whole
     regexp to match.  The next leftmost greedy (non-greedy) quantifier,
     if any, will try to match as much (little) of the string remaining
     available to it as possible, while still allowing the whole regexp to
     match.  And so on, until all the regexp elements are satisfied.

 Just like alternation, quantifiers are also susceptible to backtracking.
 Here is a step-by-step analysis of the example

     $x = "the cat in the hat";
     $x =~ /^(.*)(at)(.*)$/; # matches,
                             # $1 = 'the cat in the h'
                             # $2 = 'at'
                             # $3 = ''   (0 matches)

 0.  Start with the first letter in the string 't'.
      

 1.  The first quantifier '.*' starts out by matching the whole string
 ""the cat in the hat"".
      

 2.  'a' in the regexp element 'at' doesn't match the end of the string.
 Backtrack one character.
      

 3.  'a' in the regexp element 'at' still doesn't match the last letter of
 the string 't', so backtrack one more character.
      

 4.  Now we can match the 'a' and the 't'.
      

 5.  Move on to the third element '.*'.  Since we are at the end of the
 string and '.*' can match 0 times, assign it the empty string.
      

 6.  We are done!

 Most of the time, all this moving forward and backtracking happens
 quickly and searching is fast. There are some pathological regexps,
 however, whose execution time exponentially grows with the size of the
 string.  A typical structure that blows up in your face is of the form

     /(a|b+)*/;

 The problem is the nested indeterminate quantifiers.  There are many
 different ways of partitioning a string of length n between the '+' and
 '*': one repetition with "b+" of length n, two repetitions with the first
 "b+" length k and the second with length n-k, m repetitions whose bits
 add up to length n, _e_t_c.  In fact there are an exponential number of ways
 to partition a string as a function of its length.  A regexp may get
 lucky and match early in the process, but if there is no match, Perl will
 try _e_v_e_r_y possibility before giving up.  So be careful with nested '*''s,
 "{n,m}"'s, and '+''s.  The book _M_a_s_t_e_r_i_n_g _R_e_g_u_l_a_r _E_x_p_r_e_s_s_i_o_n_s by Jeffrey
 Friedl gives a wonderful discussion of this and other efficiency issues.

PPoosssseessssiivvee qquuaannttiiffiieerrss Backtracking during the relentless search for a match may be a waste of time, particularly when the match is bound to fail. Consider the simple pattern

     /^\w+\s+\w+$/; # a word, spaces, a word

 Whenever this is applied to a string which doesn't quite meet the
 pattern's expectations such as "abc  " or "abc  def ", the regexp engine
 will backtrack, approximately once for each character in the string.  But
 we know that there is no way around taking _a_l_l of the initial word
 characters to match the first repetition, that _a_l_l spaces must be eaten
 by the middle part, and the same goes for the second word.

 With the introduction of the _p_o_s_s_e_s_s_i_v_e _q_u_a_n_t_i_f_i_e_r_s in Perl 5.10, we have
 a way of instructing the regexp engine not to backtrack, with the usual
 quantifiers with a '+' appended to them.  This makes them greedy as well
 as stingy; once they succeed they won't give anything back to permit
 another solution. They have the following meanings:

 •   "a{n,m}+" means: match at least "n" times, not more than "m" times,
     as many times as possible, and don't give anything up. "a?+" is short
     for "a{0,1}+"

 •   "a{n,}+" means: match at least "n" times, but as many times as
     possible, and don't give anything up. "a++" is short for "a{1,}+".

 •   "a{,n}+" means: match as many times as possible up to at most "n"
     times, and don't give anything up. "a*+" is short for "a{0,}+".

 •   "a{n}+" means: match exactly "n" times.  It is just there for
     notational consistency.

 These possessive quantifiers represent a special case of a more general
 concept, the _i_n_d_e_p_e_n_d_e_n_t _s_u_b_e_x_p_r_e_s_s_i_o_n, see below.

 As an example where a possessive quantifier is suitable we consider
 matching a quoted string, as it appears in several programming languages.
 The backslash is used as an escape character that indicates that the next
 character is to be taken literally, as another character for the string.
 Therefore, after the opening quote, we expect a (possibly empty) sequence
 of alternatives: either some character except an unescaped quote or
 backslash or an escaped character.

     /"(?:[^"\\]++|\\.)*+"/;

BBuuiillddiinngg aa rreeggeexxpp At this point, we have all the basic regexp concepts covered, so let’s give a more involved example of a regular expression. We will build a regexp that matches numbers.

 The first task in building a regexp is to decide what we want to match
 and what we want to exclude.  In our case, we want to match both integers
 and floating point numbers and we want to reject any string that isn't a
 number.

 The next task is to break the problem down into smaller problems that are
 easily converted into a regexp.

 The simplest case is integers.  These consist of a sequence of digits,
 with an optional sign in front.  The digits we can represent with "\d+"
 and the sign can be matched with "[+-]".  Thus the integer regexp is

     /[+-]?\d+/;  # matches integers

 A floating point number potentially has a sign, an integral part, a
 decimal point, a fractional part, and an exponent.  One or more of these
 parts is optional, so we need to check out the different possibilities.
 Floating point numbers which are in proper form include 123., 0.345, .34,
 -1e6, and 25.4E-72.  As with integers, the sign out front is completely
 optional and can be matched by "[+-]?".  We can see that if there is no
 exponent, floating point numbers must have a decimal point, otherwise
 they are integers.  We might be tempted to model these with "\d*\.\d*",
 but this would also match just a single decimal point, which is not a
 number.  So the three cases of floating point number without exponent are

    /[+-]?\d+\./;  # 1., 321., etc.
    /[+-]?\.\d+/;  # .1, .234, etc.
    /[+-]?\d+\.\d+/;  # 1.0, 30.56, etc.

 These can be combined into a single regexp with a three-way alternation:

    /[+-]?(\d+\.\d+|\d+\.|\.\d+)/;  # floating point, no exponent

 In this alternation, it is important to put '\d+\.\d+' before '\d+\.'.
 If '\d+\.' were first, the regexp would happily match that and ignore the
 fractional part of the number.

 Now consider floating point numbers with exponents.  The key observation
 here is that _b_o_t_h integers and numbers with decimal points are allowed in
 front of an exponent.  Then exponents, like the overall sign, are
 independent of whether we are matching numbers with or without decimal
 points, and can be "decoupled" from the mantissa.  The overall form of
 the regexp now becomes clear:

     /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;

 The exponent is an 'e' or 'E', followed by an integer.  So the exponent
 regexp is

    /[eE][+-]?\d+/;  # exponent

 Putting all the parts together, we get a regexp that matches numbers:

    /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/;  # Ta da!

 Long regexps like this may impress your friends, but can be hard to
 decipher.  In complex situations like this, the "/x" modifier for a match
 is invaluable.  It allows one to put nearly arbitrary whitespace and
 comments into a regexp without affecting their meaning.  Using it, we can
 rewrite our "extended" regexp in the more pleasing form

    /^
       [+-]?         # first, match an optional sign
       (             # then match integers or f.p. mantissas:
           \d+\.\d+  # mantissa of the form a.b
          |\d+\.     # mantissa of the form a.
          |\.\d+     # mantissa of the form .b
          |\d+       # integer of the form a
       )
       ( [eE] [+-]? \d+ )?  # finally, optionally match an exponent
    $/x;

 If whitespace is mostly irrelevant, how does one include space characters
 in an extended regexp? The answer is to backslash it '\ ' or put it in a
 character class "[ ]".  The same thing goes for pound signs: use "\#" or
 "[#]".  For instance, Perl allows a space between the sign and the
 mantissa or integer, and we could add this to our regexp as follows:

    /^
       [+-]?\ *      # first, match an optional sign *and space*
       (             # then match integers or f.p. mantissas:
           \d+\.\d+  # mantissa of the form a.b
          |\d+\.     # mantissa of the form a.
          |\.\d+     # mantissa of the form .b
          |\d+       # integer of the form a
       )
       ( [eE] [+-]? \d+ )?  # finally, optionally match an exponent
    $/x;

 In this form, it is easier to see a way to simplify the alternation.
 Alternatives 1, 2, and 4 all start with "\d+", so it could be factored
 out:

    /^
       [+-]?\ *      # first, match an optional sign
       (             # then match integers or f.p. mantissas:
           \d+       # start out with a ...
           (
               \.\d* # mantissa of the form a.b or a.
           )?        # ? takes care of integers of the form a
          |\.\d+     # mantissa of the form .b
       )
       ( [eE] [+-]? \d+ )?  # finally, optionally match an exponent
    $/x;

 Starting in Perl v5.26, specifying "/xx" changes the square-bracketed
 portions of a pattern to ignore tabs and space characters unless they are
 escaped by preceding them with a backslash.  So, we could write

    /^
       [ + - ]?\ *   # first, match an optional sign
       (             # then match integers or f.p. mantissas:
           \d+       # start out with a ...
           (
               \.\d* # mantissa of the form a.b or a.
           )?        # ? takes care of integers of the form a
          |\.\d+     # mantissa of the form .b
       )
       ( [ e E ] [ + - ]? \d+ )?  # finally, optionally match an exponent
    $/xx;

 This doesn't really improve the legibility of this example, but it's
 available in case you want it.  Squashing the pattern down to the compact
 form, we have

     /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;

 This is our final regexp.  To recap, we built a regexp by

 •   specifying the task in detail,

 •   breaking down the problem into smaller parts,

 •   translating the small parts into regexps,

 •   combining the regexps,

 •   and optimizing the final combined regexp.

 These are also the typical steps involved in writing a computer program.
 This makes perfect sense, because regular expressions are essentially
 programs written in a little computer language that specifies patterns.

UUssiinngg rreegguullaarr eexxpprreessssiioonnss iinn PPeerrll The last topic of Part 1 briefly covers how regexps are used in Perl programs. Where do they fit into Perl syntax?

 We have already introduced the matching operator in its default
 "/regexp/" and arbitrary delimiter "m!regexp!" forms.  We have used the
 binding operator "=~" and its negation "!~" to test for string matches.
 Associated with the matching operator, we have discussed the single line
 "/s", multi-line "/m", case-insensitive "/i" and extended "/x" modifiers.
 There are a few more things you might want to know about matching
 operators.

 _P_r_o_h_i_b_i_t_i_n_g _s_u_b_s_t_i_t_u_t_i_o_n

 If you change $pattern after the first substitution happens, Perl will
 ignore it.  If you don't want any substitutions at all, use the special
 delimiter "m''":

     @pattern = ('Seuss');
     while (<>) {
         print if m'@pattern';  # matches literal '@pattern', not 'Seuss'
     }

 Similar to strings, "m''" acts like apostrophes on a regexp; all other
 'm' delimiters act like quotes.  If the regexp evaluates to the empty
 string, the regexp in the _l_a_s_t _s_u_c_c_e_s_s_f_u_l _m_a_t_c_h is used instead.  So we
 have

     "dog" =~ /d/;  # 'd' matches
     "dogbert" =~ //;  # this matches the 'd' regexp used before

 _G_l_o_b_a_l _m_a_t_c_h_i_n_g

 The final two modifiers we will discuss here, "/g" and "/c", concern
 multiple matches.  The modifier "/g" stands for global matching and
 allows the matching operator to match within a string as many times as
 possible.  In scalar context, successive invocations against a string
 will have "/g" jump from match to match, keeping track of position in the
 string as it goes along.  You can get or set the position with the
 "pos()" function.

 The use of "/g" is shown in the following example.  Suppose we have a
 string that consists of words separated by spaces.  If we know how many
 words there are in advance, we could extract the words using groupings:

     $x = "cat dog house"; # 3 words
     $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
                                            # $1 = 'cat'
                                            # $2 = 'dog'
                                            # $3 = 'house'

 But what if we had an indeterminate number of words? This is the sort of
 task "/g" was made for.  To extract all words, form the simple regexp
 "(\w+)" and loop over all matches with "/(\w+)/g":

     while ($x =~ /(\w+)/g) {
         print "Word is $1, ends at position ", pos $x, "\n";
     }

 prints

     Word is cat, ends at position 3
     Word is dog, ends at position 7
     Word is house, ends at position 13

 A failed match or changing the target string resets the position.  If you
 don't want the position reset after failure to match, add the "/c", as in
 "/regexp/gc".  The current position in the string is associated with the
 string, not the regexp.  This means that different strings have different
 positions and their respective positions can be set or read
 independently.

 In list context, "/g" returns a list of matched groupings, or if there
 are no groupings, a list of matches to the whole regexp.  So if we wanted
 just the words, we could use

     @words = ($x =~ /(\w+)/g);  # matches,
                                 # $words[0] = 'cat'
                                 # $words[1] = 'dog'
                                 # $words[2] = 'house'

 Closely associated with the "/g" modifier is the "\G" anchor.  The "\G"
 anchor matches at the point where the previous "/g" match left off.  "\G"
 allows us to easily do context-sensitive matching:

     $metric = 1;  # use metric units
     ...
     $x = <FILE>;  # read in measurement
     $x =~ /^([+-]?\d+)\s*/g;  # get magnitude
     $weight = $1;
     if ($metric) { # error checking
         print "Units error!" unless $x =~ /\Gkg\./g;
     }
     else {
         print "Units error!" unless $x =~ /\Glbs\./g;
     }
     $x =~ /\G\s+(widget|sprocket)/g;  # continue processing

 The combination of "/g" and "\G" allows us to process the string a bit at
 a time and use arbitrary Perl logic to decide what to do next.
 Currently, the "\G" anchor is only fully supported when used to anchor to
 the start of the pattern.

 "\G" is also invaluable in processing fixed-length records with regexps.
 Suppose we have a snippet of coding region DNA, encoded as base pair
 letters "ATCGTTGAAT..." and we want to find all the stop codons "TGA".
 In a coding region, codons are 3-letter sequences, so we can think of the
 DNA snippet as a sequence of 3-letter records.  The naive regexp

     # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
     $dna = "ATCGTTGAATGCAAATGACATGAC";
     $dna =~ /TGA/;

 doesn't work; it may match a "TGA", but there is no guarantee that the
 match is aligned with codon boundaries, _e_._g_., the substring "GTT GAA"
 gives a match.  A better solution is

     while ($dna =~ /(\w\w\w)*?TGA/g) {  # note the minimal *?
         print "Got a TGA stop codon at position ", pos $dna, "\n";
     }

 which prints

     Got a TGA stop codon at position 18
     Got a TGA stop codon at position 23

 Position 18 is good, but position 23 is bogus.  What happened?

 The answer is that our regexp works well until we get past the last real
 match.  Then the regexp will fail to match a synchronized "TGA" and start
 stepping ahead one character position at a time, not what we want.  The
 solution is to use "\G" to anchor the match to the codon alignment:

     while ($dna =~ /\G(\w\w\w)*?TGA/g) {
         print "Got a TGA stop codon at position ", pos $dna, "\n";
     }

 This prints

     Got a TGA stop codon at position 18

 which is the correct answer.  This example illustrates that it is
 important not only to match what is desired, but to reject what is not
 desired.

 (There are other regexp modifiers that are available, such as "/o", but
 their specialized uses are beyond the scope of this introduction.  )

 _S_e_a_r_c_h _a_n_d _r_e_p_l_a_c_e

 Regular expressions also play a big role in _s_e_a_r_c_h _a_n_d _r_e_p_l_a_c_e operations
 in Perl.  Search and replace is accomplished with the "s///" operator.
 The general form is "s/regexp/replacement/modifiers", with everything we
 know about regexps and modifiers applying in this case as well.  The
 _r_e_p_l_a_c_e_m_e_n_t is a Perl double-quoted string that replaces in the string
 whatever is matched with the "regexp".  The operator "=~" is also used
 here to associate a string with "s///".  If matching against $_, the
 "$_ =~" can be dropped.  If there is a match, "s///" returns the number
 of substitutions made; otherwise it returns false.  Here are a few
 examples:

     $x = "Time to feed the cat!";
     $x =~ s/cat/hacker/;   # $x contains "Time to feed the hacker!"
     if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
         $more_insistent = 1;
     }
     $y = "'quoted words'";
     $y =~ s/^'(.*)'$/$1/;  # strip single quotes,
                            # $y contains "quoted words"

 In the last example, the whole string was matched, but only the part
 inside the single quotes was grouped.  With the "s///" operator, the
 matched variables $1, $2, _e_t_c. are immediately available for use in the
 replacement expression, so we use $1 to replace the quoted string with
 just what was quoted.  With the global modifier, "s///g" will search and
 replace all occurrences of the regexp in the string:

     $x = "I batted 4 for 4";
     $x =~ s/4/four/;   # doesn't do it all:
                        # $x contains "I batted four for 4"
     $x = "I batted 4 for 4";
     $x =~ s/4/four/g;  # does it all:
                        # $x contains "I batted four for four"

 If you prefer "regex" over "regexp" in this tutorial, you could use the
 following program to replace it:

     % cat > simple_replace
     #!/usr/bin/perl
     $regexp = shift;
     $replacement = shift;
     while (<>) {
         s/$regexp/$replacement/g;
         print;
     }

^D #

     % simple_replace regexp regex perlretut.pod

 In "simple_replace" we used the "s///g" modifier to replace all
 occurrences of the regexp on each line.  (Even though the regular
 expression appears in a loop, Perl is smart enough to compile it only
 once.)  As with "simple_grep", both the "print" and the
 "s/$regexp/$replacement/g" use $_ implicitly.

 If you don't want "s///" to change your original variable you can use the
 non-destructive substitute modifier, "s///r".  This changes the behavior
 so that "s///r" returns the final substituted string (instead of the
 number of substitutions):

     $x = "I like dogs.";
     $y = $x =~ s/dogs/cats/r;
     print "$x $y\n";

 That example will print "I like dogs. I like cats". Notice the original
 $x variable has not been affected. The overall result of the substitution
 is instead stored in $y. If the substitution doesn't affect anything then
 the original string is returned:

     $x = "I like dogs.";
     $y = $x =~ s/elephants/cougars/r;
     print "$x $y\n"; # prints "I like dogs. I like dogs."

 One other interesting thing that the "s///r" flag allows is chaining
 substitutions:

     $x = "Cats are great.";
     print $x =~ s/Cats/Dogs/r =~ s/Dogs/Frogs/r =~
         s/Frogs/Hedgehogs/r, "\n";
     # prints "Hedgehogs are great."

 A modifier available specifically to search and replace is the "s///e"
 evaluation modifier.  "s///e" treats the replacement text as Perl code,
 rather than a double-quoted string.  The value that the code returns is
 substituted for the matched substring.  "s///e" is useful if you need to
 do a bit of computation in the process of replacing text.  This example
 counts character frequencies in a line:

     $x = "Bill the cat";
     $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
     print "frequency of '$_' is $chars{$_}\n"
         foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);

 This prints

     frequency of ' ' is 2
     frequency of 't' is 2
     frequency of 'l' is 2
     frequency of 'B' is 1
     frequency of 'c' is 1
     frequency of 'e' is 1
     frequency of 'h' is 1
     frequency of 'i' is 1
     frequency of 'a' is 1

 As with the match "m//" operator, "s///" can use other delimiters, such
 as "s!!!" and "s{}{}", and even "s{}//".  If single quotes are used
 "s'''", then the regexp and replacement are treated as single-quoted
 strings and there are no variable substitutions.  "s///" in list context
 returns the same thing as in scalar context, _i_._e_., the number of matches.

 _T_h_e _s_p_l_i_t _f_u_n_c_t_i_o_n

 The "split()" function is another place where a regexp is used.  "split
 /regexp/, string, limit" separates the "string" operand into a list of
 substrings and returns that list.  The regexp must be designed to match
 whatever constitutes the separators for the desired substrings.  The
 "limit", if present, constrains splitting into no more than "limit"
 number of strings.  For example, to split a string into words, use

     $x = "Calvin and Hobbes";
     @words = split /\s+/, $x;  # $word[0] = 'Calvin'
                                # $word[1] = 'and'
                                # $word[2] = 'Hobbes'

 If the empty regexp "//" is used, the regexp always matches and the
 string is split into individual characters.  If the regexp has groupings,
 then the resulting list contains the matched substrings from the
 groupings as well.  For instance,

     $x = "/usr/bin/perl";
     @dirs = split m!/!, $x;  # $dirs[0] = ''
                              # $dirs[1] = 'usr'
                              # $dirs[2] = 'bin'
                              # $dirs[3] = 'perl'
     @parts = split m!(/)!, $x;  # $parts[0] = ''
                                 # $parts[1] = '/'
                                 # $parts[2] = 'usr'
                                 # $parts[3] = '/'
                                 # $parts[4] = 'bin'
                                 # $parts[5] = '/'
                                 # $parts[6] = 'perl'

 Since the first character of $x matched the regexp, "split" prepended an
 empty initial element to the list.

 If you have read this far, congratulations! You now have all the basic
 tools needed to use regular expressions to solve a wide range of text
 processing problems.  If this is your first time through the tutorial,
 why not stop here and play around with regexps a while....  Part 2
 concerns the more esoteric aspects of regular expressions and those
 concepts certainly aren't needed right at the start.

PPaarrtt 22:: PPoowweerr ttoooollss OK, you know the basics of regexps and you want to know more. If matching regular expressions is analogous to a walk in the woods, then the tools discussed in Part 1 are analogous to topo maps and a compass, basic tools we use all the time. Most of the tools in part 2 are analogous to flare guns and satellite phones. They aren’t used too often on a hike, but when we are stuck, they can be invaluable.

 What follows are the more advanced, less used, or sometimes esoteric
 capabilities of Perl regexps.  In Part 2, we will assume you are
 comfortable with the basics and concentrate on the advanced features.

MMoorree oonn cchhaarraacctteerrss,, ssttrriinnggss,, aanndd cchhaarraacctteerr ccllaasssseess There are a number of escape sequences and character classes that we haven’t covered yet.

 There are several escape sequences that convert characters or strings
 between upper and lower case, and they are also available within
 patterns.  "\l" and "\u" convert the next character to lower or upper
 case, respectively:

     $x = "perl";
     $string =~ /\u$x/;  # matches 'Perl' in $string
     $x = "M(rs?|s)\\."; # note the double backslash
     $string =~ /\l$x/;  # matches 'mr.', 'mrs.', and 'ms.',

 A "\L" or "\U" indicates a lasting conversion of case, until terminated
 by "\E" or thrown over by another "\U" or "\L":

     $x = "This word is in lower case:\L SHOUT\E";
     $x =~ /shout/;       # matches
     $x = "I STILL KEYPUNCH CARDS FOR MY 360";
     $x =~ /\Ukeypunch/;  # matches punch card string

 If there is no "\E", case is converted until the end of the string. The
 regexps "\L\u$word" or "\u\L$word" convert the first character of $word
 to uppercase and the rest of the characters to lowercase.  (Beyond ASCII
 characters, it gets somewhat more complicated; "\u" actually performs
 _t_i_t_l_e_c_a_s_e mapping, which for most characters is the same as uppercase,
 but not for all; see <https://unicode.org/faq/casemap_charprop.html#4>.)

 Control characters can be escaped with "\c", so that a control-Z
 character would be matched with "\cZ".  The escape sequence "\Q"..."\E"
 quotes, or protects most non-alphabetic characters.   For instance,

     $x = "\QThat !^*&%~& cat!";
     $x =~ /\Q!^*&%~&\E/;  # check for rough language

 It does not protect '$' or '@', so that variables can still be
 substituted.

 "\Q", "\L", "\l", "\U", "\u" and "\E" are actually part of double-quotish
 syntax, and not part of regexp syntax proper.  They will work if they
 appear in a regular expression embedded directly in a program, but not
 when contained in a string that is interpolated in a pattern.

 Perl regexps can handle more than just the standard ASCII character set.
 Perl supports _U_n_i_c_o_d_e, a standard for representing the alphabets from
 virtually all of the world's written languages, and a host of symbols.
 Perl's text strings are Unicode strings, so they can contain characters
 with a value (codepoint or character number) higher than 255.

 What does this mean for regexps? Well, regexp users don't need to know
 much about Perl's internal representation of strings.  But they do need
 to know 1) how to represent Unicode characters in a regexp and 2) that a
 matching operation will treat the string to be searched as a sequence of
 characters, not bytes.  The answer to 1) is that Unicode characters
 greater than "chr(255)" are represented using the "\x{hex}" notation,
 because "\x"_X_Y (without curly braces and _X_Y are two hex digits) doesn't
 go further than 255.  (Starting in Perl 5.14, if you're an octal fan, you
 can also use "\o{oct}".)

     /\x{263a}/;   # match a Unicode smiley face :)
     /\x{ 263a }/; # Same

 NNOOTTEE: In Perl 5.6.0 it used to be that one needed to say "use utf8" to
 use any Unicode features.  This is no longer the case: for almost all
 Unicode processing, the explicit "utf8" pragma is not needed.  (The only
 case where it matters is if your Perl script is in Unicode and encoded in
 UTF-8, then an explicit "use utf8" is needed.)

 Figuring out the hexadecimal sequence of a Unicode character you want or
 deciphering someone else's hexadecimal Unicode regexp is about as much
 fun as programming in machine code.  So another way to specify Unicode
 characters is to use the _n_a_m_e_d _c_h_a_r_a_c_t_e_r escape sequence "\N{_n_a_m_e}".
 _n_a_m_e is a name for the Unicode character, as specified in the Unicode
 standard.  For instance, if we wanted to represent or match the
 astrological sign for the planet Mercury, we could use

     $x = "abc\N{MERCURY}def";
     $x =~ /\N{MERCURY}/;   # matches
     $x =~ /\N{ MERCURY }/; # Also matches

 One can also use "short" names:

     print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
     print "\N{greek:Sigma} is an upper-case sigma.\n";

 You can also restrict names to a certain alphabet by specifying the
 charnames pragma:

     use charnames qw(greek);
     print "\N{sigma} is Greek sigma\n";

 An index of character names is available on-line from the Unicode
 Consortium, <https://www.unicode.org/charts/charindex.html>; explanatory
 material with links to other resources at
 <https://www.unicode.org/standard/where>.

 Starting in Perl v5.32, an alternative to "\N{...}" for full names is
 available, and that is to say

  /\p{Name=greek small letter sigma}/

 The casing of the character name is irrelevant when used in "\p{}", as
 are most spaces, underscores and hyphens.  (A few outlier characters
 cause problems with ignoring all of them always.  The details (which you
 can look up when you get more proficient, and if ever needed) are in
 <https://www.unicode.org/reports/tr44/tr44-24.html#UAX44-LM2>).

 The answer to requirement 2) is that a regexp (mostly) uses Unicode
 characters.  The "mostly" is for messy backward compatibility reasons,
 but starting in Perl 5.14, any regexp compiled in the scope of a "use
 feature 'unicode_strings'" (which is automatically turned on within the
 scope of a "use v5.12" or higher) will turn that "mostly" into "always".
 If you want to handle Unicode properly, you should ensure that
 'unicode_strings' is turned on.  Internally, this is encoded to bytes
 using either UTF-8 or a native 8 bit encoding, depending on the history
 of the string, but conceptually it is a sequence of characters, not
 bytes. See perlunitut for a tutorial about that.

 Let us now discuss Unicode character classes, most usually called
 "character properties".  These are represented by the "\p{_n_a_m_e}" escape
 sequence.  The negation of this is "\P{_n_a_m_e}".  For example, to match
 lower and uppercase characters,

     $x = "BOB";
     $x =~ /^\p{IsUpper}/;   # matches, uppercase char class
     $x =~ /^\P{IsUpper}/;   # doesn't match, char class sans uppercase
     $x =~ /^\p{IsLower}/;   # doesn't match, lowercase char class
     $x =~ /^\P{IsLower}/;   # matches, char class sans lowercase

 (The ""Is"" is optional.)

 There are many, many Unicode character properties.  For the full list see
 perluniprops.  Most of them have synonyms with shorter names, also listed
 there.  Some synonyms are a single character.  For these, you can drop
 the braces.  For instance, "\pM" is the same thing as "\p{Mark}", meaning
 things like accent marks.

 The Unicode "\p{Script}" and "\p{Script_Extensions}" properties are used
 to categorize every Unicode character into the language script it is
 written in.  For example, English, French, and a bunch of other European
 languages are written in the Latin script.  But there is also the Greek
 script, the Thai script, the Katakana script, _e_t_c.  ("Script" is an
 older, less advanced, form of "Script_Extensions", retained only for
 backwards compatibility.)  You can test whether a character is in a
 particular script  with, for example "\p{Latin}", "\p{Greek}", or
 "\p{Katakana}".  To test if it isn't in the Balinese script, you would
 use "\P{Balinese}".  (These all use "Script_Extensions" under the hood,
 as that gives better results.)

 What we have described so far is the single form of the "\p{...}"
 character classes.  There is also a compound form which you may run into.
 These look like "\p{_n_a_m_e=_v_a_l_u_e}" or "\p{_n_a_m_e:_v_a_l_u_e}" (the equals sign and
 colon can be used interchangeably).  These are more general than the
 single form, and in fact most of the single forms are just Perl-defined
 shortcuts for common compound forms.  For example, the script examples in
 the previous paragraph could be written equivalently as
 "\p{Script_Extensions=Latin}", "\p{Script_Extensions:Greek}",
 "\p{script_extensions=katakana}", and "\P{script_extensions=balinese}"
 (case is irrelevant between the "{}" braces).  You may never have to use
 the compound forms, but sometimes it is necessary, and their use can make
 your code easier to understand.

 "\X" is an abbreviation for a character class that comprises a Unicode
 _e_x_t_e_n_d_e_d _g_r_a_p_h_e_m_e _c_l_u_s_t_e_r.  This represents a "logical character": what
 appears to be a single character, but may be represented internally by
 more than one.  As an example, using the Unicode full names, _e_._g_.,
 "A + COMBINING RING" is a grapheme cluster with base character "A" and
 combining character "COMBINING RING, which translates in Danish to "A"
 with the circle atop it, as in the word Ångstrom.

 For the full and latest information about Unicode see the latest Unicode
 standard, or the Unicode Consortium's website <https://www.unicode.org>

 As if all those classes weren't enough, Perl also defines POSIX-style
 character classes.  These have the form "[:_n_a_m_e:]", with _n_a_m_e the name of
 the POSIX class.  The POSIX classes are "alpha", "alnum", "ascii",
 "cntrl", "digit", "graph", "lower", "print", "punct", "space", "upper",
 and "xdigit", and two extensions, "word" (a Perl extension to match
 "\w"), and "blank" (a GNU extension).  The "/a" modifier restricts these
 to matching just in the ASCII range; otherwise they can match the same as
 their corresponding Perl Unicode classes: "[:upper:]" is the same as
 "\p{IsUpper}", _e_t_c.  (There are some exceptions and gotchas with this;
 see perlrecharclass for a full discussion.) The "[:digit:]", "[:word:]",
 and "[:space:]" correspond to the familiar "\d", "\w", and "\s" character
 classes.  To negate a POSIX class, put a '^' in front of the name, so
 that, _e_._g_., "[:^digit:]" corresponds to "\D" and, under Unicode,
 "\P{IsDigit}".  The Unicode and POSIX character classes can be used just
 like "\d", with the exception that POSIX character classes can only be
 used inside of a character class:

     /\s+[abc[:digit:]xyz]\s*/;  # match a,b,c,x,y,z, or a digit
     /^=item\s[[:digit:]]/;      # match '=item',
                                 # followed by a space and a digit
     /\s+[abc\p{IsDigit}xyz]\s+/;  # match a,b,c,x,y,z, or a digit
     /^=item\s\p{IsDigit}/;        # match '=item',
                                   # followed by a space and a digit

 Whew! That is all the rest of the characters and character classes.

CCoommppiilliinngg aanndd ssaavviinngg rreegguullaarr eexxpprreessssiioonnss In Part 1 we mentioned that Perl compiles a regexp into a compact sequence of opcodes. Thus, a compiled regexp is a data structure that can be stored once and used again and again. The regexp quote “qr//” does exactly that: “qr/string/” compiles the “string” as a regexp and transforms the result into a form that can be assigned to a variable:

     $reg = qr/foo+bar?/;  # reg contains a compiled regexp

 Then $reg can be used as a regexp:

     $x = "fooooba";
     $x =~ $reg;     # matches, just like /foo+bar?/
     $x =~ /$reg/;   # same thing, alternate form

 $reg can also be interpolated into a larger regexp:

     $x =~ /(abc)?$reg/;  # still matches

 As with the matching operator, the regexp quote can use different
 delimiters, _e_._g_., "qr!!", "qr{}" or "qr~~".  Apostrophes as delimiters
 ("qr''") inhibit any interpolation.

 Pre-compiled regexps are useful for creating dynamic matches that don't
 need to be recompiled each time they are encountered.  Using pre-compiled
 regexps, we write a "grep_step" program which greps for a sequence of
 patterns, advancing to the next pattern as soon as one has been
 satisfied.

     % cat > grep_step
     #!/usr/bin/perl
     # grep_step - match <number> regexps, one after the other
     # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...

     $number = shift;
     $regexp[$_] = shift foreach (0..$number-1);
     @compiled = map qr/$_/, @regexp;
     while ($line = <>) {
         if ($line =~ /$compiled[0]/) {
             print $line;
             shift @compiled;
             last unless @compiled;
         }
     }

^D #

     % grep_step 3 shift print last grep_step
     $number = shift;
             print $line;
             last unless @compiled;

 Storing pre-compiled regexps in an array @compiled allows us to simply
 loop through the regexps without any recompilation, thus gaining
 flexibility without sacrificing speed.

CCoommppoossiinngg rreegguullaarr eexxpprreessssiioonnss aatt rruunnttiimmee Backtracking is more efficient than repeated tries with different regular expressions. If there are several regular expressions and a match with any of them is acceptable, then it is possible to combine them into a set of alternatives. If the individual expressions are input data, this can be done by programming a join operation. We’ll exploit this idea in an improved version of the “simple_grep” program: a program that matches multiple patterns:

     % cat > multi_grep
     #!/usr/bin/perl
     # multi_grep - match any of <number> regexps
     # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...

     $number = shift;
     $regexp[$_] = shift foreach (0..$number-1);
     $pattern = join '|', @regexp;

     while ($line = <>) {
         print $line if $line =~ /$pattern/;
     }

^D #

     % multi_grep 2 shift for multi_grep
     $number = shift;
     $regexp[$_] = shift foreach (0..$number-1);

 Sometimes it is advantageous to construct a pattern from the _i_n_p_u_t that
 is to be analyzed and use the permissible values on the left hand side of
 the matching operations.  As an example for this somewhat paradoxical
 situation, let's assume that our input contains a command verb which
 should match one out of a set of available command verbs, with the
 additional twist that commands may be abbreviated as long as the given
 string is unique. The program below demonstrates the basic algorithm.

     % cat > keymatch
     #!/usr/bin/perl
     $kwds = 'copy compare list print';
     while( $cmd = <> ){
         $cmd =~ s/^\s+|\s+$//g;  # trim leading and trailing spaces
         if( ( @matches = $kwds =~ /\b$cmd\w*/g ) == 1 ){
             print "command: '@matches'\n";
         } elsif( @matches == 0 ){
             print "no such command: '$cmd'\n";
         } else {
             print "not unique: '$cmd' (could be one of: @matches)\n";
         }
     }

^D #

     % keymatch
     li
     command: 'list'
     co
     not unique: 'co' (could be one of: copy compare)
     printer
     no such command: 'printer'

 Rather than trying to match the input against the keywords, we match the
 combined set of keywords against the input.  The pattern matching
 operation "$kwds =~ /\b($cmd\w*)/g" does several things at the same time.
 It makes sure that the given command begins where a keyword begins
 ("\b"). It tolerates abbreviations due to the added "\w*". It tells us
 the number of matches ("scalar @matches") and all the keywords that were
 actually matched.  You could hardly ask for more.

EEmmbbeeddddiinngg ccoommmmeennttss aanndd mmooddiiffiieerrss iinn aa rreegguullaarr eexxpprreessssiioonn Starting with this section, we will be discussing Perl’s set of _e_x_t_e_n_d_e_d _p_a_t_t_e_r_n_s. These are extensions to the traditional regular expression syntax that provide powerful new tools for pattern matching. We have already seen extensions in the form of the minimal matching constructs “??”, “*?”, “+?”, “{n,m}?”, “{n,}?”, and “{,n}?”. Most of the extensions below have the form “(?char…)”, where the “char” is a character that determines the type of extension.

 The first extension is an embedded comment "(?#text)".  This embeds a
 comment into the regular expression without affecting its meaning.  The
 comment should not have any closing parentheses in the text.  An example
 is

     /(?# Match an integer:)[+-]?\d+/;

 This style of commenting has been largely superseded by the raw, freeform
 commenting that is allowed with the "/x" modifier.

 Most modifiers, such as "/i", "/m", "/s" and "/x" (or any combination
 thereof) can also be embedded in a regexp using "(?i)", "(?m)", "(?s)",
 and "(?x)".  For instance,

     /(?i)yes/;  # match 'yes' case insensitively
     /yes/i;     # same thing
     /(?x)(          # freeform version of an integer regexp
              [+-]?  # match an optional sign
              \d+    # match a sequence of digits
          )
     /x;

 Embedded modifiers can have two important advantages over the usual
 modifiers.  Embedded modifiers allow a custom set of modifiers for _e_a_c_h
 regexp pattern.  This is great for matching an array of regexps that must
 have different modifiers:

     $pattern[0] = '(?i)doctor';
     $pattern[1] = 'Johnson';
     ...
     while (<>) {
         foreach $patt (@pattern) {
             print if /$patt/;
         }
     }

 The second advantage is that embedded modifiers (except "/p", which
 modifies the entire regexp) only affect the regexp inside the group the
 embedded modifier is contained in.  So grouping can be used to localize
 the modifier's effects:

     /Answer: ((?i)yes)/;  # matches 'Answer: yes', 'Answer: YES', etc.

 Embedded modifiers can also turn off any modifiers already present by
 using, _e_._g_., "(?-i)".  Modifiers can also be combined into a single
 expression, _e_._g_., "(?s-i)" turns on single line mode and turns off case
 insensitivity.

 Embedded modifiers may also be added to a non-capturing grouping.
 "(?i-m:regexp)" is a non-capturing grouping that matches "regexp" case
 insensitively and turns off multi-line mode.

LLooookkiinngg aahheeaadd aanndd llooookkiinngg bbeehhiinndd This section concerns the lookahead and lookbehind assertions. First, a little background.

 In Perl regular expressions, most regexp elements "eat up" a certain
 amount of string when they match.  For instance, the regexp element
 "[abc]" eats up one character of the string when it matches, in the sense
 that Perl moves to the next character position in the string after the
 match.  There are some elements, however, that don't eat up characters
 (advance the character position) if they match.  The examples we have
 seen so far are the anchors.  The anchor '^' matches the beginning of the
 line, but doesn't eat any characters.  Similarly, the word boundary
 anchor "\b" matches wherever a character matching "\w" is next to a
 character that doesn't, but it doesn't eat up any characters itself.
 Anchors are examples of _z_e_r_o_-_w_i_d_t_h _a_s_s_e_r_t_i_o_n_s: zero-width, because they
 consume no characters, and assertions, because they test some property of
 the string.  In the context of our walk in the woods analogy to regexp
 matching, most regexp elements move us along a trail, but anchors have us
 stop a moment and check our surroundings.  If the local environment
 checks out, we can proceed forward.  But if the local environment doesn't
 satisfy us, we must backtrack.

 Checking the environment entails either looking ahead on the trail,
 looking behind, or both.  '^' looks behind, to see that there are no
 characters before.  '$' looks ahead, to see that there are no characters
 after.  "\b" looks both ahead and behind, to see if the characters on
 either side differ in their "word-ness".

 The lookahead and lookbehind assertions are generalizations of the anchor
 concept.  Lookahead and lookbehind are zero-width assertions that let us
 specify which characters we want to test for.  The lookahead assertion is
 denoted by "(?=regexp)" or (starting in 5.32, experimentally in 5.28)
 "(*pla:regexp)" or "(*positive_lookahead:regexp)"; and the lookbehind
 assertion is denoted by "(?<=fixed-regexp)" or (starting in 5.32,
 experimentally in 5.28) "(*plb:fixed-regexp)" or
 "(*positive_lookbehind:fixed-regexp)".  Some examples are

     $x = "I catch the housecat 'Tom-cat' with catnip";
     $x =~ /cat(*pla:\s)/;   # matches 'cat' in 'housecat'
     @catwords = ($x =~ /(?<=\s)cat\w+/g);  # matches,
                                            # $catwords[0] = 'catch'
                                            # $catwords[1] = 'catnip'
     $x =~ /\bcat\b/;  # matches 'cat' in 'Tom-cat'
     $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
                               # middle of $x

 Note that the parentheses in these are non-capturing, since these are
 zero-width assertions.  Thus in the second regexp, the substrings
 captured are those of the whole regexp itself.  Lookahead can match
 arbitrary regexps, but lookbehind prior to 5.30 "(?<=fixed-regexp)" only
 works for regexps of fixed width, _i_._e_., a fixed number of characters
 long.  Thus "(?<=(ab|bc))" is fine, but "(?<=(ab)*)" prior to 5.30 is
 not.

 The negated versions of the lookahead and lookbehind assertions are
 denoted by "(?!regexp)" and "(?<!fixed-regexp)" respectively.  Or,
 starting in 5.32 (experimentally in 5.28), "(*nla:regexp)",
 "(*negative_lookahead:regexp)", "(*nlb:regexp)", or
 "(*negative_lookbehind:regexp)".  They evaluate true if the regexps do
 _n_o_t match:

     $x = "foobar";
     $x =~ /foo(?!bar)/;  # doesn't match, 'bar' follows 'foo'
     $x =~ /foo(?!baz)/;  # matches, 'baz' doesn't follow 'foo'
     $x =~ /(?<!\s)foo/;  # matches, there is no \s before 'foo'

 Here is an example where a string containing blank-separated words,
 numbers and single dashes is to be split into its components.  Using
 "/\s+/" alone won't work, because spaces are not required between dashes,
 or a word or a dash. Additional places for a split are established by
 looking ahead and behind:

     $str = "one two - --6-8";
     @toks = split / \s+              # a run of spaces
                   | (?<=\S) (?=-)    # any non-space followed by '-'
                   | (?<=-)  (?=\S)   # a '-' followed by any non-space
                   /x, $str;          # @toks = qw(one two - - - 6 - 8)

UUssiinngg iinnddeeppeennddeenntt ssuubbeexxpprreessssiioonnss ttoo pprreevveenntt bbaacckkttrraacckkiinngg _I_n_d_e_p_e_n_d_e_n_t _s_u_b_e_x_p_r_e_s_s_i_o_n_s (or atomic subexpressions) are regular expressions, in the context of a larger regular expression, that function independently of the larger regular expression. That is, they consume as much or as little of the string as they wish without regard for the ability of the larger regexp to match. Independent subexpressions are represented by “(?>regexp)” or (starting in 5.32, experimentally in 5.28) “(*atomic:regexp)”. We can illustrate their behavior by first considering an ordinary regexp:

     $x = "ab";
     $x =~ /a*ab/;  # matches

 This obviously matches, but in the process of matching, the subexpression
 "a*" first grabbed the 'a'.  Doing so, however, wouldn't allow the whole
 regexp to match, so after backtracking, "a*" eventually gave back the 'a'
 and matched the empty string.  Here, what "a*" matched was _d_e_p_e_n_d_e_n_t on
 what the rest of the regexp matched.

 Contrast that with an independent subexpression:

     $x =~ /(?>a*)ab/;  # doesn't match!

 The independent subexpression "(?>a*)" doesn't care about the rest of the
 regexp, so it sees an 'a' and grabs it.  Then the rest of the regexp "ab"
 cannot match.  Because "(?>a*)" is independent, there is no backtracking
 and the independent subexpression does not give up its 'a'.  Thus the
 match of the regexp as a whole fails.  A similar behavior occurs with
 completely independent regexps:

     $x = "ab";
     $x =~ /a*/g;   # matches, eats an 'a'
     $x =~ /\Gab/g; # doesn't match, no 'a' available

 Here "/g" and "\G" create a "tag team" handoff of the string from one
 regexp to the other.  Regexps with an independent subexpression are much
 like this, with a handoff of the string to the independent subexpression,
 and a handoff of the string back to the enclosing regexp.

 The ability of an independent subexpression to prevent backtracking can
 be quite useful.  Suppose we want to match a non-empty string enclosed in
 parentheses up to two levels deep.  Then the following regexp matches:

     $x = "abc(de(fg)h";  # unbalanced parentheses
     $x =~ /\( ( [ ^ () ]+ | \( [ ^ () ]* \) )+ \)/xx;

 The regexp matches an open parenthesis, one or more copies of an
 alternation, and a close parenthesis.  The alternation is two-way, with
 the first alternative "[^()]+" matching a substring with no parentheses
 and the second alternative "\([^()]*\)"  matching a substring delimited
 by parentheses.  The problem with this regexp is that it is pathological:
 it has nested indeterminate quantifiers of the form "(a+|b)+".  We
 discussed in Part 1 how nested quantifiers like this could take an
 exponentially long time to execute if no match were possible.  To prevent
 the exponential blowup, we need to prevent useless backtracking at some
 point.  This can be done by enclosing the inner quantifier as an
 independent subexpression:

     $x =~ /\( ( (?> [ ^ () ]+ ) | \([ ^ () ]* \) )+ \)/xx;

 Here, "(?>[^()]+)" breaks the degeneracy of string partitioning by
 gobbling up as much of the string as possible and keeping it.   Then
 match failures fail much more quickly.

CCoonnddiittiioonnaall eexxpprreessssiioonnss A _c_o_n_d_i_t_i_o_n_a_l _e_x_p_r_e_s_s_i_o_n is a form of if-then-else statement that allows one to choose which patterns are to be matched, based on some condition. There are two types of conditional expression: “(?(_c_o_n_d_i_t_i_o_n)_y_e_s_-_r_e_g_e_x_p)” and “(?(condition)_y_e_s_-_r_e_g_e_x_p|_n_o_-_r_e_g_e_x_p)”. “(?(_c_o_n_d_i_t_i_o_n)_y_e_s_-_r_e_g_e_x_p)” is like an ‘if () {}’ statement in Perl. If the _c_o_n_d_i_t_i_o_n is true, the _y_e_s_- _r_e_g_e_x_p will be matched. If the _c_o_n_d_i_t_i_o_n is false, the _y_e_s_-_r_e_g_e_x_p will be skipped and Perl will move onto the next regexp element. The second form is like an ‘if () {} else {}’ statement in Perl. If the _c_o_n_d_i_t_i_o_n is true, the _y_e_s_-_r_e_g_e_x_p will be matched, otherwise the _n_o_-_r_e_g_e_x_p will be matched.

 The _c_o_n_d_i_t_i_o_n can have several forms.  The first form is simply an
 integer in parentheses "(_i_n_t_e_g_e_r)".  It is true if the corresponding
 backreference "\_i_n_t_e_g_e_r" matched earlier in the regexp.  The same thing
 can be done with a name associated with a capture group, written as
 "(<_n_a_m_e>)" or "('_n_a_m_e')".  The second form is a bare zero-width assertion
 "(?...)", either a lookahead, a lookbehind, or a code assertion
 (discussed in the next section).  The third set of forms provides tests
 that return true if the expression is executed within a recursion ("(R)")
 or is being called from some capturing group, referenced either by number
 ("(R1)", "(R2)",...) or by name ("(R&_n_a_m_e)").

 The integer or name form of the "condition" allows us to choose, with
 more flexibility, what to match based on what matched earlier in the
 regexp. This searches for words of the form "$x$x" or "$x$y$y$x":

     % simple_grep '^(\w+)(\w+)?(?(2)\g2\g1|\g1)$' /usr/dict/words
     beriberi
     coco
     couscous
     deed
     ...
     toot
     toto
     tutu

 The lookbehind "condition" allows, along with backreferences, an earlier
 part of the match to influence a later part of the match.  For instance,

/[ATGC]+(?(?<=AA)G|C)$/; #

 matches a DNA sequence such that it either ends in "AAG", or some other
 base pair combination and 'C'.  Note that the form is "(?(?<=AA)G|C)" and
 not "(?((?<=AA))G|C)"; for the lookahead, lookbehind or code assertions,
 the parentheses around the conditional are not needed.

DDeeffiinniinngg nnaammeedd ppaatttteerrnnss Some regular expressions use identical subpatterns in several places. Starting with Perl 5.10, it is possible to define named subpatterns in a section of the pattern so that they can be called up by name anywhere in the pattern. This syntactic pattern for this definition group is “(?(DEFINE)(?<_n_a_m_e>_p_a_t_t_e_r_n)…)”. An insertion of a named pattern is written as “(?&_n_a_m_e)”.

 The example below illustrates this feature using the pattern for floating
 point numbers that was presented earlier on.  The three subpatterns that
 are used more than once are the optional sign, the digit sequence for an
 integer and the decimal fraction.  The "DEFINE" group at the end of the
 pattern contains their definition.  Notice that the decimal fraction
 pattern is the first place where we can reuse the integer pattern.

    /^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
       (?: [eE](?&osg)(?&int) )?
     $

(?(DEFINE) #

       (?<osg>[-+]?)         # optional sign
       (?<int>\d++)          # integer
       (?<dec>\.(?&int))     # decimal fraction
     )/x

RReeccuurrssiivvee ppaatttteerrnnss This feature (introduced in Perl 5.10) significantly extends the power of Perl’s pattern matching. By referring to some other capture group anywhere in the pattern with the construct “(?_g_r_o_u_p_-_r_e_f)”, the _p_a_t_t_e_r_n within the referenced group is used as an independent subpattern in place of the group reference itself. Because the group reference may be contained _w_i_t_h_i_n the group it refers to, it is now possible to apply pattern matching to tasks that hitherto required a recursive parser.

 To illustrate this feature, we'll design a pattern that matches if a
 string contains a palindrome. (This is a word or a sentence that, while
 ignoring spaces, interpunctuation and case, reads the same backwards as
 forwards. We begin by observing that the empty string or a string
 containing just one word character is a palindrome. Otherwise it must
 have a word character up front and the same at its end, with another
 palindrome in between.

  /(?: (\w) (?...Here be a palindrome...) \g{ -1 } | \w? )/x

 Adding "\W*" at either end to eliminate what is to be ignored, we already
 have the full pattern:

     my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
     for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
         print "'$s' is a palindrome\n" if $s =~ /$pp/;
     }

 In "(?...)" both absolute and relative backreferences may be used.  The
 entire pattern can be reinserted with "(?R)" or "(?0)".  If you prefer to
 name your groups, you can use "(?&_n_a_m_e)" to recurse into that group.

AA bbiitt ooff mmaaggiicc:: eexxeeccuuttiinngg PPeerrll ccooddee iinn aa rreegguullaarr eexxpprreessssiioonn Normally, regexps are a part of Perl expressions. _C_o_d_e _e_v_a_l_u_a_t_i_o_n expressions turn that around by allowing arbitrary Perl code to be a part of a regexp. A code evaluation expression is denoted “(?{_c_o_d_e})”, with _c_o_d_e a string of Perl statements.

 Code expressions are zero-width assertions, and the value they return
 depends on their environment.  There are two possibilities: either the
 code expression is used as a conditional in a conditional expression
 "(?(_c_o_n_d_i_t_i_o_n)...)", or it is not.  If the code expression is a
 conditional, the code is evaluated and the result (_i_._e_., the result of
 the last statement) is used to determine truth or falsehood.  If the code
 expression is not used as a conditional, the assertion always evaluates
 true and the result is put into the special variable $^R.  The variable
 $^R can then be used in code expressions later in the regexp.  Here are
 some silly examples:

     $x = "abcdef";
     $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
                                          # prints 'Hi Mom!'
     $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
                                          # no 'Hi Mom!'

 Pay careful attention to the next example:

     $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
                                          # no 'Hi Mom!'
                                          # but why not?

 At first glance, you'd think that it shouldn't print, because obviously
 the "ddd" isn't going to match the target string. But look at this
 example:

     $x =~ /abc(?{print "Hi Mom!";})[dD]dd/; # doesn't match,
                                             # but _does_ print

 Hmm. What happened here? If you've been following along, you know that
 the above pattern should be effectively (almost) the same as the last
 one; enclosing the 'd' in a character class isn't going to change what it
 matches. So why does the first not print while the second one does?

 The answer lies in the optimizations the regexp engine makes. In the
 first case, all the engine sees are plain old characters (aside from the
 "?{}" construct). It's smart enough to realize that the string 'ddd'
 doesn't occur in our target string before actually running the pattern
 through. But in the second case, we've tricked it into thinking that our
 pattern is more complicated. It takes a look, sees our character class,
 and decides that it will have to actually run the pattern to determine
 whether or not it matches, and in the process of running it hits the
 print statement before it discovers that we don't have a match.

 To take a closer look at how the engine does optimizations, see the
 section "Pragmas and debugging" below.

 More fun with "?{}":

     $x =~ /(?{print "Hi Mom!";})/;         # matches,
                                            # prints 'Hi Mom!'
     $x =~ /(?{$c = 1;})(?{print "$c";})/;  # matches,
                                            # prints '1'
     $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
                                            # prints '1'

 The bit of magic mentioned in the section title occurs when the regexp
 backtracks in the process of searching for a match.  If the regexp
 backtracks over a code expression and if the variables used within are
 localized using "local", the changes in the variables produced by the
 code expression are undone! Thus, if we wanted to count how many times a
 character got matched inside a group, we could use, _e_._g_.,

     $x = "aaaa";
     $count = 0;  # initialize 'a' count
     $c = "bob";  # test if $c gets clobbered
     $x =~ /(?{local $c = 0;})         # initialize count
            ( a                        # match 'a'
              (?{local $c = $c + 1;})  # increment count
            )*                         # do this any number of times,
            aa                         # but match 'aa' at the end
            (?{$count = $c;})          # copy local $c var into $count
           /x;
     print "'a' count is $count, \$c variable is '$c'\n";

 This prints

     'a' count is 2, $c variable is 'bob'

 If we replace the " (?{local $c = $c + 1;})" with " (?{$c = $c + 1;})",
 the variable changes are _n_o_t undone during backtracking, and we get

     'a' count is 4, $c variable is 'bob'

 Note that only localized variable changes are undone.  Other side effects
 of code expression execution are permanent.  Thus

     $x = "aaaa";
     $x =~ /(a(?{print "Yow\n";}))*aa/;

 produces

    Yow
    Yow
    Yow
    Yow

 The result $^R is automatically localized, so that it will behave
 properly in the presence of backtracking.

 This example uses a code expression in a conditional to match a definite
 article, either 'the' in English or 'der|die|das' in German:

     $lang = 'DE';  # use German
     ...
     $text = "das";
     print "matched\n"
         if $text =~ /(?(?{
                           $lang eq 'EN'; # is the language English?
                          })
                        the |             # if so, then match 'the'
                        (der|die|das)     # else, match 'der|die|das'
                      )
                     /xi;

 Note that the syntax here is "(?(?{...})_y_e_s_-_r_e_g_e_x_p|_n_o_-_r_e_g_e_x_p)", not
 "(?((?{...}))_y_e_s_-_r_e_g_e_x_p|_n_o_-_r_e_g_e_x_p)".  In other words, in the case of a
 code expression, we don't need the extra parentheses around the
 conditional.

 If you try to use code expressions where the code text is contained
 within an interpolated variable, rather than appearing literally in the
 pattern, Perl may surprise you:

     $bar = 5;
     $pat = '(?{ 1 })';
     /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
     /foo(?{ 1 })$bar/;   # compiles ok, $bar interpolated
     /foo${pat}bar/;      # compile error!

     $pat = qr/(?{ $foo = 1 })/;  # precompile code regexp
     /foo${pat}bar/;      # compiles ok

 If a regexp has a variable that interpolates a code expression, Perl
 treats the regexp as an error. If the code expression is precompiled into
 a variable, however, interpolating is ok. The question is, why is this an
 error?

 The reason is that variable interpolation and code expressions together
 pose a security risk.  The combination is dangerous because many
 programmers who write search engines often take user input and plug it
 directly into a regexp:

     $regexp = <>;       # read user-supplied regexp
     $chomp $regexp;     # get rid of possible newline
     $text =~ /$regexp/; # search $text for the $regexp

 If the $regexp variable contains a code expression, the user could then
 execute arbitrary Perl code.  For instance, some joker could search for
 "system('rm -rf *');" to erase your files.  In this sense, the
 combination of interpolation and code expressions _t_a_i_n_t_s your regexp.  So
 by default, using both interpolation and code expressions in the same
 regexp is not allowed.  If you're not concerned about malicious users, it
 is possible to bypass this security check by invoking "use re 'eval'":

     use re 'eval';       # throw caution out the door
     $bar = 5;
     $pat = '(?{ 1 })';
     /foo${pat}bar/;      # compiles ok

 Another form of code expression is the _p_a_t_t_e_r_n _c_o_d_e _e_x_p_r_e_s_s_i_o_n.  The
 pattern code expression is like a regular code expression, except that
 the result of the code evaluation is treated as a regular expression and
 matched immediately.  A simple example is

     $length = 5;
     $char = 'a';
     $x = 'aaaaabb';
     $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'

 This final example contains both ordinary and pattern code expressions.
 It detects whether a binary string 1101010010001... has a Fibonacci
 spacing 0,1,1,2,3,5,...  of the '1''s:

     $x = "1101010010001000001";
     $z0 = ''; $z1 = '0';   # initial conditions
     print "It is a Fibonacci sequence\n"
         if $x =~ /^1         # match an initial '1'
                     (?:
                        ((??{ $z0 })) # match some '0'
                        1             # and then a '1'
                        (?{ $z0 = $z1; $z1 .= $^N; })
                     )+   # repeat as needed
                   $      # that is all there is
                  /x;
     printf "Largest sequence matched was %d\n", length($z1)-length($z0);

 Remember that $^N is set to whatever was matched by the last completed
 capture group. This prints

     It is a Fibonacci sequence
     Largest sequence matched was 5

 Ha! Try that with your garden variety regexp package...

 Note that the variables $z0 and $z1 are not substituted when the regexp
 is compiled, as happens for ordinary variables outside a code expression.
 Rather, the whole code block is parsed as perl code at the same time as
 perl is compiling the code containing the literal regexp pattern.

 This regexp without the "/x" modifier is

     /^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/

 which shows that spaces are still possible in the code parts.
 Nevertheless, when working with code and conditional expressions, the
 extended form of regexps is almost necessary in creating and debugging
 regexps.

BBaacckkttrraacckkiinngg ccoonnttrrooll vveerrbbss Perl 5.10 introduced a number of control verbs intended to provide detailed control over the backtracking process, by directly influencing the regexp engine and by providing monitoring techniques. See “Special Backtracking Control Verbs” in perlre for a detailed description.

 Below is just one example, illustrating the control verb "(*FAIL)", which
 may be abbreviated as "(*F)". If this is inserted in a regexp it will
 cause it to fail, just as it would at some mismatch between the pattern
 and the string. Processing of the regexp continues as it would after any
 "normal" failure, so that, for instance, the next position in the string
 or another alternative will be tried. As failing to match doesn't
 preserve capture groups or produce results, it may be necessary to use
 this in combination with embedded code.

    %count = ();
    "supercalifragilisticexpialidocious" =~
        /([aeiou])(?{ $count{$1}++; })(*FAIL)/i;
    printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);

 The pattern begins with a class matching a subset of letters.  Whenever
 this matches, a statement like "$count{'a'}++;" is executed, incrementing
 the letter's counter. Then "(*FAIL)" does what it says, and the regexp
 engine proceeds according to the book: as long as the end of the string
 hasn't been reached, the position is advanced before looking for another
 vowel. Thus, match or no match makes no difference, and the regexp engine
 proceeds until the entire string has been inspected.  (It's remarkable
 that an alternative solution using something like

    $count{lc($_)}++ for split('', "supercalifragilisticexpialidocious");
    printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } );

 is considerably slower.)

PPrraaggmmaass aanndd ddeebbuuggggiinngg Speaking of debugging, there are several pragmas available to control and debug regexps in Perl. We have already encountered one pragma in the previous section, “use re ’eval’;”, that allows variable interpolation and code expressions to coexist in a regexp. The other pragmas are

     use re 'taint';
     $tainted = <>;
     @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted

 The "taint" pragma causes any substrings from a match with a tainted
 variable to be tainted as well, if your perl supports tainting (see
 perlsec).  This is not normally the case, as regexps are often used to
 extract the safe bits from a tainted variable.  Use "taint" when you are
 not extracting safe bits, but are performing some other processing.  Both
 "taint" and "eval" pragmas are lexically scoped, which means they are in
 effect only until the end of the block enclosing the pragmas.

     use re '/m';  # or any other flags
     $multiline_string =~ /^foo/; # /m is implied

 The "re '/flags'" pragma (introduced in Perl 5.14) turns on the given
 regular expression flags until the end of the lexical scope.  See
 "'/flags' mode" in re for more detail.

     use re 'debug';
     /^(.*)$/s;       # output debugging info

     use re 'debugcolor';
     /^(.*)$/s;       # output debugging info in living color

 The global "debug" and "debugcolor" pragmas allow one to get detailed
 debugging info about regexp compilation and execution.  "debugcolor" is
 the same as debug, except the debugging information is displayed in color
 on terminals that can display termcap color sequences.  Here is example
 output:

     % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
     Compiling REx 'a*b+c'
     size 9 first at 1

1: STAR(4) #

        2:   EXACT <a>(0)

4: PLUS(7) #

        5:   EXACT <b>(0)
        7: EXACT <c>(9)

9: END(0) #

     floating 'bc' at 0..2147483647 (checking floating) minlen 2
     Guessing start of match, REx 'a*b+c' against 'abc'...
     Found floating substr 'bc' at offset 1...
     Guessed: match at offset 0
     Matching REx 'a*b+c' against 'abc'
       Setting an EVAL scope, savestack=3
        0 <> <abc>           |  1:  STAR
                              EXACT <a> can match 1 times out of 32767...
       Setting an EVAL scope, savestack=3
        1 <a> <bc>           |  4:    PLUS
                              EXACT <b> can match 1 times out of 32767...
       Setting an EVAL scope, savestack=3
        2 <ab> <c>           |  7:      EXACT <c>
        3 <abc> <>           |  9:      END
     Match successful!
     Freeing REx: 'a*b+c'

 If you have gotten this far into the tutorial, you can probably guess
 what the different parts of the debugging output tell you.  The first
 part

     Compiling REx 'a*b+c'
     size 9 first at 1

1: STAR(4) #

        2:   EXACT <a>(0)

4: PLUS(7) #

        5:   EXACT <b>(0)
        7: EXACT <c>(9)

9: END(0) #

 describes the compilation stage.  STAR(4) means that there is a starred
 object, in this case 'a', and if it matches, goto line 4, _i_._e_., PLUS(7).
 The middle lines describe some heuristics and optimizations performed
 before a match:

     floating 'bc' at 0..2147483647 (checking floating) minlen 2
     Guessing start of match, REx 'a*b+c' against 'abc'...
     Found floating substr 'bc' at offset 1...
     Guessed: match at offset 0

 Then the match is executed and the remaining lines describe the process:

     Matching REx 'a*b+c' against 'abc'
       Setting an EVAL scope, savestack=3
        0 <> <abc>           |  1:  STAR
                              EXACT <a> can match 1 times out of 32767...
       Setting an EVAL scope, savestack=3
        1 <a> <bc>           |  4:    PLUS
                              EXACT <b> can match 1 times out of 32767...
       Setting an EVAL scope, savestack=3
        2 <ab> <c>           |  7:      EXACT <c>
        3 <abc> <>           |  9:      END
     Match successful!
     Freeing REx: 'a*b+c'

 Each step is of the form "n <x> <y>", with "<x>" the part of the string
 matched and "<y>" the part not yet matched.  The "|  1:  STAR" says that
 Perl is at line number 1 in the compilation list above.  See "Debugging
 Regular Expressions" in perldebguts for much more detail.

 An alternative method of debugging regexps is to embed "print" statements
 within the regexp.  This provides a blow-by-blow account of the
 backtracking in an alternation:

     "that this" =~ m@(?{print "Start at position ", pos, "\n";})
                      t(?{print "t1\n";})
                      h(?{print "h1\n";})
                      i(?{print "i1\n";})
                      s(?{print "s1\n";})
                          |
                      t(?{print "t2\n";})
                      h(?{print "h2\n";})
                      a(?{print "a2\n";})
                      t(?{print "t2\n";})
                      (?{print "Done at position ", pos, "\n";})
                     @x;

 prints

     Start at position 0
     t1
     h1
     t2
     h2
     a2
     t2
     Done at position 4

SSEEEE AALLSSOO #

 This is just a tutorial.  For the full story on Perl regular expressions,
 see the perlre regular expressions reference page.

 For more information on the matching "m//" and substitution "s///"
 operators, see "Regexp Quote-Like Operators" in perlop.  For information
 on the "split" operation, see "split" in perlfunc.

 For an excellent all-around resource on the care and feeding of regular
 expressions, see the book _M_a_s_t_e_r_i_n_g _R_e_g_u_l_a_r _E_x_p_r_e_s_s_i_o_n_s by Jeffrey Friedl
 (published by O'Reilly, ISBN 1556592-257-3).

AAUUTTHHOORR AANNDD CCOOPPYYRRIIGGHHTT #

 Copyright (c) 2000 Mark Kvale.  All rights reserved.  Now maintained by
 Perl porters.

 This document may be distributed under the same terms as Perl itself.

AAcckknnoowwlleeddggmmeennttss The inspiration for the stop codon DNA example came from the ZIP code example in chapter 7 of _M_a_s_t_e_r_i_n_g _R_e_g_u_l_a_r _E_x_p_r_e_s_s_i_o_n_s.

 The author would like to thank Jeff Pinyan, Andrew Johnson, Peter
 Haworth, Ronald J Kimball, and Joe Smith for all their helpful comments.

perl v5.36.3 2023-02-15 PERLRETUT(1)